For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:31160218-31160309 92bp GCAGAACATTGACTCGTCCT GCGCCTCTCCTCACAGAGAT
Mut= 92 bp
Wt= 92 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CTGTCTCAGCTCCAGCTCAGGGCATCTGATGCCTCTGGCTTCTGTGTGTACTCATGTAATTGTGCACGTACCCACCTACATACATGTGCTTGCAGATGAATGTTAAAGCTAGCCTACTCATTTTACGATCTGTGCTACTGTGTTATTGTCACGTTTACataaaggataacttttaaccatttgtatctgtgttctcacttagaatgaaaatctgtttctcaagagtaaagagacctttaaagaaatgaactaacttgtctactatcccattctcctagggctgctttggaagaggtagaaggagatgtggctgagctggaactaaaactcgacaaggtaagctttccctttaagtctgcagaacattgactcgtcctttccgtgatgagcggttagcGCCCACCACAGTGGCTGGTTTATGTACCTGAGATCTCTGTGAGGAGAGGCGCTGTCATCCTGGCTTGCTGCATGAGGAAATGAAGGCTAGATATGTTGAGCAGCTTGCAGGTTCCAAGATGAGTTGTCAAAACTGGTGTCCGCGCCTCACTTCAGAACCT
This mutation is a 239 bp deletion beginning at Chromosome 16 position 31,160,270 bp and ending after 31,160,508 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39471 | GCA GAA CAT TGA CTC GTC CT | Wild type Forward | A | |||
| 39472 | GCG CCT CTC CTC ACA GAG AT | Common | A | |||
| 39473 | CAT TTT ACG ATC TGT GCT ACT GTG | Mutant Forward | A | |||
| 39474 | Fluorophore-1 | TTC CGT GAT GAG CGG TTA G | Quencher-1 | WT Probe | ||
| 39475 | Fluorophore-2 | ATT GTC ACG TTT ACG CCC A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39471 | 0.40 uM |
| 39472 | 0.40 uM |
| 39473 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.