For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:127967488-127967586 99bp TCTGCCCAGAGGAGTAACCT TCATGAGGTCTCTCTGAAGATCA
Mut= 121 bp
Wt= 99 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case):
ACCCATGGACTTGCTTTCCAGACTTCAGAAAACAGGGGTTACGTGACCCTTCTGTTCAGGGTAGTGGGAAACACCCACTGAGGTTTTGGCTTTGAGAGCCAGTGACCTGGGTTCTCCCCCGTAGACCAACCAGTCATACCCAGACCCAGCCTCCCTTCTGAGCATGGGGTCCTCTCTGCCCAGAGGAGTAACCTGACACACATTTGTGTAGTTTTCTGGTTTCCCCcttcgtctcactgaacactgaagttgatcttcagagagacctcatgaggtatatgaagctgcctcgtcccatttactgtaggggagaccgaggcatgcagtgacaagggggcatgtcataggctttgggtctgtgacagcgcctggctttttataatcattttgtatctcagagtcagtggtgagagacatgcatggggtggggtggtctgggagatgaatgtaagagctgtgctggtctaaccagtttcttctttctccagctctgtggctgtgggctgcttggagtgggcatctggctctctgtgtcccaaggcaacttcgccaccttctcccccagcttcccctcactgtccgcagccaacctcgtcatcgccatcggcaccatcgtcatggtgacgggcttcctgggctgcctgggggccatcaaggagaacaagtgtctgcttctcagcgtaagtcggccctcgcgttcccttcgttgctctctggggctccctagctgaagtccacagacattgcttctagagcgttctgtccccagcccttcctgtccccctctctctttgacacatgcctgggtttgcttaggagtgggtggtgcccacttccaggctcccagcctggaaaccctgcccatcccttatctcccctcccctgccccattctctgtcaccacccaccccggccatctccactcccctgggcccacgcttgcacttgtctttccagttcttcatcgtgctgttgatcatcctgctggcagagttgattctgatcatcctcttcttcgtctacatggacaaggtaaacctcgcagaggcaggcaagatggaaggtcgccatcttgacaccagggctgggacaggggaacgcctggctaacagatcctgcagactggtctgcaggaggcctgagggtcccaccctagccacttcccctccccgtctggaaacactgctccagcattcccagctggcccagtctgggttagggaggagggccagtggcctggtctcagctgacctgtggtgtttcccctcatctgccaggtgaacgagaatgccaagcaggacctgaaagaggggctgctgctctacaacacagagaacaacgtggggctcaagaacgcctggaacatcatccaggccgaggtgcggctccagtctgtgcatggcgtaggatggggcagccatagtgcacctgtgctgttgggagaaccacctgcactggacacttgcctagacctgaagggagatgctagcatgggatgctgccggggaggggtaaagaggtgggcgcacgaggcacatgatgcgtgtctcaggagtgggcgagcctaacgtggtgaatgacaggagtcaccagatcacgtttggctcaggtgacaggctctggtagtgacaggaatacaagtctctgttgcccgatgcacaccccacatagaccctgccaatcagcttgggagggcccgtactacaaaggaaggaggtcaaggcactggtgagcaagtattgggctgggctctttaactccacatctggtgctcagcccagagggacagcagcctttctggtgtaggaaagaagagtcactcactacctctgggggcccggctgcagctcaagaggggacaaggagacattcttttccctatccctgtgttcttgggtggggttgacgtatctggccttgtgccccacagatgcggtgttgtggggtcactgactacacagactggtatccggtgctcggggagaacacagttcctgacagatgctgcatggagaattcccagggctgtgggcgcaacagcaccacccccttgtggagaacggtgagactcactgatcccctgtgcgctggcagcaggaatgatgggaattagtgcagtgtgggatggagagagggctacactggagtgaagccagcagtgctgtgtgtgtgtgtgtgtgtgtgtacacatgcacgtatgtgcaggactcacacttgggattcagaaggtaaggggttggatggggattaggcagtgcagctgcctgctgtaagtggagcctgggggttggatgttgcttctggggagggccagggcctaagggtagtaacggactagaattcagaataaagacaggggctagggcaaaatgacggaagggttgggatggccccaaccagtgtcgtgccaggaccttaccctgtggttcacccccccagggctgctacgaaaaagtgaagctgtggtttgatgacaacaagcacgtgctaggcaccgtgggcatgtgcatcctcatcatgcaggtgaggggaccccgggcacctcgactctgggtggacgcaagccagagccaccgccaggctgcagggctccgagtgaggccacaggcaatgggcaaaggtggtgctcagtgctaggcggggccctgacatgctccgcatgagagctaaaggtgttcagtgtcccccgggtcaccagCTTTACAGGTGACATGTGGCACCTTGGGTGAAGCCACAGGTGGCCCCTGCCTGCACCTCTGTGTCTCCACctgctttcAGGGTTTTAGCTGAGGAGCGTAAATGGGATTTGATGTTGTTCAAGACAGTTATCCAAGACATCACTTCACGTGTTCTAGAACCACAGAGCTTGTTGGCATGAATGCCAATGACTCGAACACCCCCTTG
This mutation is a 2472 bp deletion beginning at Chromosome 6 position 127,965,063 bp and ending after 127,967,534 bp (GRCm38/mm10). In addition there is an 8 bp deletion (CTGCTTTC) 70 bp after the 2472 bp deletion that will not affect the results of the deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39262 | TCT GCC CAG AGG AGT AAC CT | Common | A | |||
| 39263 | TCA TGA GGT CTC TCT GAA GAT CA | Wild type Reverse | A | |||
| 39264 | TGG AGA CAC AGA GGT GCA G | Mutant Reverse | A | |||
| 39265 | Fluorophore-1 | CTT CGT CTC ACT GAA CAC TGA AGT | Quencher-1 | WT Probe | ||
| 39266 | Fluorophore-2 | TTC TGG TTT CCC CCT TTA CAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39262 | 0.40 uM |
| 39263 | 0.40 uM |
| 39264 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.