For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:105686820+105686979 160bp TTGCATGCTTCCTGTTTTCA TCCTTGGCTTTCCGTAGTTC
Mut= 126 bp
Wt= 160 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletions in lower case and insertion with carrots ^ t ^ (t insertion):
TTAAATAAAAGTATTGTATTTTAATAGCTGTATTCCTTGTCAGACAGCTAGAACATATACCCCTAATTCTGCTAAAACTATGGAAAACGATCACCAGTTTGCTTGCAAATCAACTCTGCTGCATGCGTTCACAAGTTTC^ataaagg^TTGCATGCTTCCTGTTTTCAATACAAATTGTGTTTTTTTCATACCCATCTTTGCTTTTTATTTTTTTTATTTTTGTTTCCCTTttcttggttggatgcctgtgtgtgtttaatccaaatccctgtccagtcctggagtttgaactacggaaagccaaggagaccattcaggccctccgagccaacctaacaaaggctgcaggtggtgtacataaaactttttgagccttttcccacttttacaatgtagaagtagccggactatttttaagtgtaaaatagtaaaacattatctcattttatctcaccagaacatgaagttcctttacaggaacgaaaaaattataaatcaagtcctgaaattcaggtgggtgattgacaacaccagttatcttccatacaacccaagtgtcaaaggagcaaagctcacattttcccatctgtcttttaactttttttccaggagccaatcaaacctcttgaaaagagagctctcaacttcctagtcaatgagtttttgttaaagaataactacaagcttacatcaataaccttttcagatgaaaatgatgatcaggtacagttactgttttaagtaatgtctacttttaatctactgtttctctaacttgatttttaacacttatgcctgtaataagagtccatgtgggtagtttctaaaatcaaagcaggtactactcagtttagtattcaattggctcacaaaccttttctatttaaataaacctttttaaataaagacttatgtttctttccaggTAACTTTTTATAGCCTGATAGTAACTGTATAGCCCCTTCATGTTTGTATTCATTCATAATGTATGTTTTTCTAAGACTGAGTAATTACTTGCTTTTATTGATCATTGCAGACTTAGAAATTGAGTTTAACTATAAAAAAATTTCTTGAGTAGCACTGTATATAATTCAGATGTTCAGTAGCAATGGTTGGAGGTTTTTTT
This muation is a 696 bp deletion beginning at Chromosome 1 position 105,686,903 bp and ending after 105,687,598 bp (GRCm38/mm10). In addition, there is a single bp (T) insertion and 7 bp deletion (ATAAAGG) 83 bp before the 696 bp deletion that will not affect the results of the mutation.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39187 | TTG CAT GCT TCC TGT TTT CA | Common | A | |||
| 39188 | TCC TTG GCT TTC CGT AGT TC | Wild type Reverse | A | |||
| 39189 | ACA TGA AGG GGC TAT ACA GTT ACT ATC | Mutant Reverse | A | |||
| 39190 | Fluorophore-1 | AAT CCA AAT CCC TGT CCA GTC | Quencher-1 | WT Probe | ||
| 39191 | Fluorophore-2 | TTG TTT CCC TTT AAC TTT TTA TAG CCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39187 | 0.40 uM |
| 39188 | 0.40 uM |
| 39189 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.