For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 96 bp
Wild Type = 129 bp
>chr6:83446426-83446554 129bp AGCAGGCCACAGAGGATATG CAAAGCCTGGATGGTTGG
Sequence
Wt Sequence (deleted regions in lower case)
TGAAAGTTCTGTTATATTCTCAACAGTTACTCCATACTCTGGGATTGTTGGCTCATTAAAACTGCAGCCTAAATCCTAAGGTCACGTCTGCTCACTGTGCTGTGGTAACTGGTTAGCTGTCCAAGCCTTCACCCAGCCCACAGTGAGTTGTACAGCTGCCAAGTTTTGAAGCTGGAAAAGCTGGCCCTGGCTCCCATGAGATGGGCGGCCGTGGCagaagttactggctgcctccctcacctggatttgggaagcatcccaacatgtgtcatttgcattgcagctgtgggcaaatccacctttgtgaagttactcatgaaaactcacccggagtggcaggtggcgacagaacctatagcagagtggcagaatattcaggctgctggagcccaaaaagtaagttttcagctgtggggggtagttggcagacatgcacgcagtctaattggagtaatttaatttactctgaagacatgaagtagcccagcttgtctcctttttaaaataacttcattctagaaagcaggccacagaggatatgacttgtttggatatgtttagttttgatttttgtggcttctgtatgtctgtgCAAgcgcctgcctcctgtctttgtggtttCCCAAGCATGCCCAACCATCCAGGCTTTGAAAATGAATGTTGTCATTCCTACCCTTAAGTATTTATATTGTTGTTATTGAAGCTGGCTGGCAGGAGCAATAGTCAACGAGGACATCTTAGATGTGGGAAGGGACCTCACTGAGCATCTGGTCACCCTTTGAGTCAATGCA
377 bp deletion retention of 3 bp (CAA)of endogenous sequence and further deletion of 26 bp, beginning at Chromosome 6 negative strand position 83,496,866 bp and ending after 83,496,461 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38321 | TGT ACA GCT GCC AAG TTT TGA | Mutant Forward | A | |||
| 38322 | CAA AGC CTG GAT GGT TGG | Common | A | |||
| 38323 | AGC AGG CCA CAG AGG ATA TG | Wild type Forward | A | |||
| 38325 | Fluorophore-1 | CTG CCT CCT GTC TTT GTG GT | Quencher-1 | WT Probe | ||
| 39135 | Fluorophore-2 | AAA AGC TGG CCC TGG CTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38321 | 0.40 uM |
| 38322 | 0.40 uM |
| 38323 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.