For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:156250527-156250614 88bp TCCTCCTCCCACTCTGTTCA CCCTGATAAGCTCCCGTAGG
Mut= 86 bp
Wt= 88 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CCTTTCTTCTCCAGTTTCGATGACCTACTTATTCACATTCCTTTTCAAGTTCACTTGCCTGGCTACAGCATGTAGGTGTTAAAGCAAAGTGCCTTCCCTGCTGATCCTCTAGCCTGTGACACAAAAGCAGGCTCAGGACATGTGAGAGTCTCCTCCTCCCACTCTGTTCATACCTTCACCAGGCCAATgccctgctcaccaagatggaaaggggaaatcctacgggagcttatcaggggggcccgctatcacctcccttctcagatctgcttagggtacgccaggaagtagcaactgcaacactgaggggtcccagtggcttggaagttcacctgccctcgtctacagcagaccatcgacggaagcaaggcctagttcagcgccgggaaggggcggttccagctgctgccacatctttctctgaaaggtattaagacgtgcttcagcaaggccccacatgctatgcttgttacttgagaaggccaattctttctttcccttgagtcttccatcacatatatgcataatgcattcaccacgttcaaggtccactgcaggaagctcctaaaactactgcaaagactcaatttggggggcaaaatatgcagaaatgcccactccctggcaagaatgccaaatgcaattttcttgtcaagcaactctgagtattccagcctagtagagctgccccgagagcagaggccctcCCCTCACAGGTGGTGGTGGTGGGATGTTGAGGAAGGCAAGGAGAAAGCAACCACAGAGGATTCAGAGTGAAGGACATACGCCCCCTCCATCCCTACCCTGCTATAAACTCCAGAGACATCATGCTCACAGTAGTCTCCGCGGCAGACGAGTTAAGCCAAGGAGAGCATTAGGCAG
This mutation is a 519 bp deletion beginning at Chromosome 4 position 156,250,058 bp and ending after 156,250,576 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39037 | TCC TCC TCC CAC TCT GTT CA | Common | A | |||
| 39038 | CCC TGA TAA GCT CCC GTA GG | Wild type Reverse | A | |||
| 39039 | GCT TTC TCC TTG CCT TCC TC | Mutant Reverse | A | |||
| 39040 | Fluorophore-1 | CCC TGC TCA CCA AGA TGG | Quencher-1 | WT Probe | ||
| 39041 | Fluorophore-2 | CCA ATC CCT CAC AGG TGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39037 | 0.40 uM |
| 39038 | 0.40 uM |
| 39039 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.