For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:152040726+152040816 91bp CAGCCTGTCCTGTGTTCTACA ACCATGCCCTGCTCAAAAG
Mut= 95 bp
Wt= 91 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GCCACTGCCCTTACCCAATGAGCAGCCGTTGCGGGCTCCATGCTGTGTAGTTTGGGTTTCCTTGTCAGGTGTGGCTGGTGACATGCACTCTGAATGCAGGGATGGTTGGATTTTAATGATAGGAAGAACAGCCTGTCCTGTGTTCTACATAGTTCTGGGACAGCCAGagtcttaaggccctcaatcaagaaagaaaaatccttttgagcagggcatggtggcgcacgcctttaatcccagcacttgggaggcagaggcaggtgaatttctgagttcaaggccagcctggtctacagagtgagttccagggcagcaagggctatatagagaaaccctgtctcgaaaaaccaaaaaaaaaaaagaaaaagaaaaagaaaaaaaaggaaaagtccttttgataggtaaatcactagttagggtgtttaatggtttttttcttttcacactagggtttcactttcagtgggatctgccgtgtgacttgcgtctacggccagttggaagtatacggccatatcatcaaccaagggcagcctccccaagatgtcttttctgtctacacccactcttacctgaccatcaatggggttccgtacgcagaacccgagaaaagtgagaaggcgatcaggagggagatccgggccctgctcaagccttacacgaaactaggtaattggctcccgcttccgatgtcaaggctgatgacgaaggcttattatgggctggacgttgcgctgattcctcatggggggtgtcttacgttatgagagttgaagctggtaggtggcacacttcgatggcctgtctccacccaggtgtaccggtgaccagtgacaacctagAGCTTAGCAGTTGGGACAAGACCCTGCAGGCTCTAGAATTGTCACTGTTGCTGAGGTGTCTTGCTCTTCTTTGGCAGATGACAGAAACTGGGTGGTGCGGTACTTCCCTCCTCTGGGCTCCATTATGATTCTGGAACGGATGCAGTCTCGTTTTGTGGACTTCCTGAAGACCTATAAGTGCTCCTCATACGTGCTCCTGCAGGAGGTAAAG
This mutation is a 675 bp deletion beginning at Chromosome 4 position 152,040,765 bp and ending after 152,041,439 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39032 | CAG CCT GTC CTG TGT TCT ACA | Common | A | |||
| 39033 | ACC ATG CCC TGC TCA AAA G | Wild type Reverse | A | |||
| 39034 | CCT CAG CAA CAG TGA CAA TTC | Mutant Reverse | A | |||
| 39035 | Fluorophore-1 | AGG CCC TCA ATC AAG AAA GAA | Quencher-1 | WT Probe | ||
| 39036 | Fluorophore-2 | ACA GCC AGA GCT TAG CAG TTG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39032 | 0.40 uM |
| 39033 | 0.40 uM |
| 39034 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.