For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:123840401-123840500 100bp TCTCCTTCCCCATTTGAGTG GCTTTGACTCTTAGTCTCACCACA
Mut= 96 bp
Wt= 100 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CATACCAACTATTTGTTGACTTGCTGTATATACATAGTGCTAGGTTGGTGGTAGATACAGGGATGAATTTTTTAAAAAACAAAACAAAAAACCCCACCCGTGCCCAATCAGCAAGCTGTTTCAGTGTCTATGGGGACTTAGTACACTTGACTCTCCTACCTGaatagttgaatgtcctgtgtgtttccaaggttacacttactccttgtgcttcttggtgttatttctacttctttctcagacttacttttcagtacatctaagatgcgtgtcaattctagggctgttaaaatgtgaagtagacaaatgtgtctctctagttacgtgttcctatttgttgtcttaaagatgcagcgacagaactaagccatgaatttaaggaaggcggagagccaatcacagatgacagcaccagtttgcacaagttttcttacaaacttgagtatcttctgcaagtaagtggcccctgtcatgcactggttttgtcagagttgtgtctccttccccatttgagtgactgttagcagtttccagggtgTGGTTCGGAAAGCACAGTGAAGCAGTTAAGTCCTTGTGGTGAGACTAAGAGTCAAAGCAGTGCCAGGAGCTCAGTCCTTCCACGTGAGTCAGGGTGTTCTGGGAACTGAAAACATTCTTCTGAGACTTAAGCCATCGTAAGGCAAGTCACAGGCCTTTCCAGCATTACACCCTTTGAGAACTTGTCGA
This mutation is a 376 bp deletion beginning at Chromosome 9 negative strand position 123,840,459 bp and ending after 123,840,834 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38712 | TCT CCT TCC CCA TTT GAG TG | Wild type Forward | A | |||
| 38713 | GCT TTG ACT CTT AGT CTC ACC ACA | Common | A | |||
| 38714 | TGT CTA TGG GGA CTT AGT ACA CTT G | Mutant Forward | A | |||
| 38715 | Fluorophore-1 | ACT GTT AGC AGT TTC CAG GGT G | Quencher-1 | WT Probe | ||
| 38716 | Fluorophore-2 | TCT CCT ACC TGT GGT TCG GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38712 | 0.40 uM |
| 38713 | 0.40 uM |
| 38714 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.