For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:42970045+42970140 96bp TGCTTGTGTGTCTGTCTTTCTGT GGGAGGAAGATGATGTACACG
Mut= 95 bp
Wt= 96 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAGACTAGCCTAAAACTCTCAATCCTCCTACTCAGACTTTATAGAGTACTGAGATTACAGACATGCAACACCATGCCATGTACACATTCCTAAATAGATATCCAATTGAGTAGAAATTAACCTCGTCCAAAGCCTTTCTTATTCTGTCAGCGTGGTCCTCTCTGGGGGTTAGAGACTGCTTGCTTCCCTCAGCCCAGGAGCCAGCATTTAGTGGCAGAGGgaagggactggggtggggcgaggatggaccacactgcccctaacttctcgtcccctttaggcctcaagaccggcggtggttcctcaggtggttccggtggctcctttcactacacctttcatggggaccctcatgccacctttgcttccttctttggtggctccaaccccttcgatatcttctttgccagcagccgctccactcggcccttcagtggctttgaccctgatgacatggatgtggatgaagatgaggacccatttggtgcctttggccgctttggcttcaatgggctgagtaggggtccaaggcgagccccagagccactgtacccccggcgcaaggtacaggacccccctgtggtgcacgagctgcgggtgtccctggaggagatctaccatggctccaccaagcggatgaagatcacaaggcggcgccttaaccctgacgggcgaactgtgcgcaccgaggacaaaatcctgcacattgtcatcaaacgaggctggaaagaaggtaccaagattaccttccccaaagagggcgacgccacacctgacaacatcccagccgacattgtcttcgtgctcaaagacaagcctcatgcacacttccgccgagatggcaccaacgtgctctacagtgccctcatcagcctcaaggaggtgtgtgtgtgtgtgtgtgtgtgtgttcgcacgtgtgtatgtatgtgcttgtgtgtctgtctttctgtctgttagagggtgataggaatcatttcctgcctgcctgccatggtCTTTTCCCGTGTACATCATCTTCCTCCCTCTCCACTCTTTGCCTACTTTTCCCTCACTCTGTGTTATTGTTTTCCAGGCGCTGTGTGGCTGCACCGTGAACATTCCCACCATTGATGGCCGAGTGATCCCTTTACCCTGCAATGATGTTATCAAGCCAGGCACCGTGAAAAGACTCCGTGGGGAGGGACTTCCCTTCCCCAAGGTGCCCACTCAGCGGGGAGACCTCATT
This mutation is a 775 bp deletion beginning at Chromosome 4 positive strand position 42,956,466 bp and ending after 42,957,240 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38657 | TGC TTG TGT GTC TGT CTT TCT GT | Wild type Forward | A | |||
| 38658 | GGG AGG AAG ATG ATG TAC ACG | Common | A | |||
| 38659 | GGT CCT CTC TGG GGG TTA GA | Mutant Forward | A | |||
| 38660 | Fluorophore-1 | CTG TTA GAG GGT GAT AGG AAT CAT TT | Quencher-1 | WT Probe | ||
| 38661 | Fluorophore-2 | TTT AGT GGC AGA GGC TTT TCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38657 | 0.40 uM |
| 38658 | 0.40 uM |
| 38659 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.