For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:110884741+110884839 99bp TTCAGCCCTTTACCCTAGCA GGCGTTGATGGGTAGTCCT
Mut= 98 bp
Wt= 99 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence: (deleted region in lower case)
TTTGACCTTGGGCAGGTGTTTTCCTCTCTCACAACCTGTCTGTGTATCTCTAAGGTGGTTGGGAGTGACCCTGAAGACTCCACGTTCTGCATCTGGGTCTAAAGAGAAGAGGCAGAGACTCAGGGGAGCTAGAAATCTTGGTTCCCCAAAATGATTAGGGTTGTCCTGTTAAGCAGGAGGCACACATACAAGCCTCATTACTCAGGGTTCAGCCCTTTACCCTAGCATGCCCTGCCCctgaggagctctatggggtactaatacagtcctgagcctcctagagctacaggactacccatcaacgccagctcagggtggctctgctttccacagacccggagccctcagatccctgtggcaaagagtgccttcggcttctgcagcagctgcatgagagtgcccagcggttgtggtatgtgacagagcaaagcctgctttcgctgcggcagaggctataccacccaccttccaagggtctagaggccgtgctgttactgagcaatgctgaccatgtcctacaagcccacatggagtaagacgccctgctctcacccctgcctttggacagtttgttgcttggccacagtgccagagtgccatctctgctatttgatcctaagggtcagctggggtgggtctcctatggtctagggtattggcttggtagcaggcatataggctcaggcctggaccagacctatgagatacaactgttgggtcatggcttgagggcaactgcctagaccatcaggattCTGGCTGCTCAGTGGGTGGTATCTGGGACCCCCCAAGAGGGCAGAGTCTGAGTGTGCATTGGGAGCTGGGCTTTCAAGGTGATCCTGGGTTGCTCATAGATACATCAAGTCCTACACTGATTGCGTGGTGGCGCAAGCTTTTCAGAAGGTCTCAAAGAAGAGGAGG
This mutation is a 518 bp deletion beginning at Chromosome 9 positive strand position 110,884,771 bp and ending after 110,885,288 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38635 | TTC AGC CCT TTA CCC TAG CA | Common | A | |||
| 38636 | GGC GTT GAT GGG TAG TCC T | Wild type Reverse | A | |||
| 38637 | CAG CTC CCA ATG CAC ACT C | Mutant Reverse | A | |||
| 38638 | Fluorophore-1 | AGT CCT GAG CCT CCT AGA GCT AC | Quencher-1 | WT Probe | ||
| 38639 | Fluorophore-2 | CTG CCC CTG GCT GCT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38635 | 0.40 uM |
| 38636 | 0.40 uM |
| 38637 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.