For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 113 bp
Wild Type = 117 bp
>chrX:60295009-60295125 117bp AGCAAAGAAATACCCACTGCT TCTTAAGCTGGTAATGAGCAAGG
Sequence
Wt Sequence (deleted region in lower case):
CAGTTTCAAAATCATTACTTAAATTGTTTGTATAAGAAAAATCTGTTTGTGTAATGGAACCATTAATGATTTCTTCAAATCTTCATGGGGATTTCAGTTAACTATATGCATGCTACAAATGCAATACTCTCAACTGTCAGTTTCAAGGAAAGTTTTAAGTTGTTTTTCTTTTCCCTttgaaatccttttgaggcagagataattatctagttgttggtagtttaaaatagtatcctatatttggtgggtaatatccatcaacatttgtaatattcgctgatccctattactgttaaacattgctgtttctggaaccagttttatatagttataaaaaaagaaataatttatatttgattatcttctgctgtcatatagacacattatgcagtacgagataccattgcactgtgtacagccgaatccattgataatctccgagcaacaattgaatgtgagcagcctcaacctgatctctacaggtaagaagaccttgcttcaccttacttatgtctgttgtctctgcttctttttcctaccagtgtagcaaagaaatacccactgcttatttaccagcttgctctttgtatgtttttataagctgttcttattccaaggAAGGGAGATGAATCAAATTAGCCTTGCTCATTACCAGCTTAAGATAAATCATTATGGACCCAAGCGTCCTATGTTTTTCTTTTCTTTTAGTTACTTGGATCAGTTTTTTAGATGGTTAACCTAAGCTTCATCTATTAGACTAATAGAGTATCTAGAGTTAATTAAAACAAAAA
442 bp deletion beginning at Chromosome X negative strand position 60,295,494 bp and ending after 60,295,053 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38525 | GCA TGC TAC AAA TGC AAT ACT C | Common | A | |||
| 38526 | TCT TAA GCT GGT AAT GAG CAA GG | Mutant Reverse | A | |||
| 38527 | AGC AAA GAA ATA CCC ACT GCT | Wild type Reverse | A | |||
| 38529 | Fluorophore-1 | CAA CTG TCA GTT TCA AGG AAA GTT T | Quencher-1 | MUT Probe | ||
| 38530 | Fluorophore-2 | CCA GCT TGC TCT TTG TAT GTT TT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38525 | 0.40 uM |
| 38526 | 0.40 uM |
| 38527 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.