For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:15069061+15069141 81bp ATGCCTGCTCCTGAAGGACT CCCAACATACATCCCTTGCT
Mut= 82 bp
Wt= 81 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence: (deleted region in lower case)
TCGTTGTCTGATACCACTCTCACCAGTCCTAAGTGTTAGCACAGGCACCTACCATTCCTTGAAGACATCAGTCCATTCTTGTATATATTGGTTCTTCACTTTGACAGGAAGGGATGGCTCTAATCCCCCAGTTGTAAGGCTGACACTTCTTCTCTGTGATCTCTCCACCTCTACATTCAGGGATCCTCTCCAGGGCCCCAAACATGCCTGCTCCTGAAGGACTCTAAGGAgtgcccaagtatttcagtctctcatgccaaagaaagcaagggatgtatgttgggcatagctctattaataaaccacagccgcctgctgttctttgtagctttctgtgtatactgacacatactgaaaagaggagcgcacaagtagaaaacgttgtttggcttttccccatcatcttttatcccttcccactgagggatgggtacacagagggggcctgtctagtctgtcagtgtcaccaaatctaccagttgtcctatgaccaacggagcttcttggctctcttaggtaccggtctcaagcggcttcttacggagaagctaagaggcagcgtttcctcagtgagctggcccagctggaggagaatgtccacctggcccggtcacaggctcgggacaagctagacaagtacttcatggagcagacggtaggaggacctgcaagctcctccctcggggtgtagaaaaggagagtttgtctgcacgcaaatggtctaatgcttcactaaccGTGGGCTGCTCCTGCCACACCCACTCTGACCACCCTCTCTTCTCCCCCATAGGTGGAAGACAATCTGGCGTGGGAGAGACACTCATTTGAAGACCGAATGAGCAGGGCCCCTGAGATCCTGGTGAGGTTAAGGTCCCACACCATCTGGGAGCGGATGTCTGTGAGGCTCTGTTTCACTGTGCAAGGATTCCCCACGCCTGTGGTGCAAT
This mutation is a 508 bp deletion beginning at Chromosome 8 negative strand position 15,069,595 bp and ending after 15,069,088 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38450 | ATG CCT GCT CCT GAA GGA CT | Common | A | |||
| 38451 | CCC AAC ATA CAT CCC TTG CT | Wild type Reverse | A | |||
| 38452 | CAC CTA TGG GGG AGA AGA GA | Mutant Reverse | A | |||
| 38453 | Fluorophore-1 | TAT TTC AGT CTC TCA TGC CAA AGA | Quencher-1 | WT Probe | ||
| 38454 | Fluorophore-2 | TAA GGA GTG GGC TGC TCC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38450 | 0.40 uM |
| 38451 | 0.40 uM |
| 38452 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.