For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:3871052-3871142 91bp AGTTGTTTCTCCTGCATTATGG CAGATAGGTCTCAATCCACCA
Mut= 98 bp
Wt= 91 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence: (deleted region in lower case)
TTAGGAAACTCCTAAAAACTATTTCTCAGGATTCTTACTGGGCTGGCCAGTGTCGTCCCCCCCCCCTTCCCCTCCCTTCTTAGAGAATCCGAAATAATTTCTCTCCCCAAGAATTGTTCACTTATCTTTTCAGGAAAGACTACGTTCTCACGGTGTACTTCTTGATTCTCACACCACTGTTTGAAAATTTATGTTTATGCTCTCTCCCCCACCCTATTCAAGCCATAGAGTTCCCccagggaggaatattttacaccaagccttttcgccttagaatgcggaggggtttagctcttttcagccttccaggacactcaactgacctgctagctttttatactaacaacagtgcttctgtttcagagaccactgctatttgaagatctggatgtgtatttttctcaagaggaatgtgtgagtctgcaccctgctcagaagaccctcagcagagaagccccattgaagagttttgagaatttggactcgataggtaagacagttgtttctcctgcattatggaactttcatcagttctaggatgaacattgtatgccttgtccacacTGGTGGTGGATTGAGACCTATCTGTGACACACACACACACACACATATTGTGTATTATGTATACGTATCTATCTATCTATCTATCTATCAAAATCACATGTATATGTGGATTTCTATAGCTATAGCAAGAACTTGTAGGAGAGAACAAGTGTCAGAGTCAGATAATGTTTTCCCTTGTGTGAGCATGAGGGCCAGTGCACATGCATTAGTGTGCAGGCCAGTGGTGATGTCAGGTGACTTTCTCATTTGTTCTCCACTCTA
This mutation is a 329 bp deletion beginning at Chromosome 16 negative strand position 3,871,404 bp and ending after 3,871,076 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38296 | AGT TGT TTC TCC TGC ATT ATG G | Wild type Forward | A | |||
| 38297 | CAG ATA GGT CTC AAT CCA CCA | Common | A | |||
| 38298 | TTG ATT CTC ACA CCA CTG TTT G | Mutant Forward | A | |||
| 38299 | Fluorophore-1 | CTA GGA TGA ACA TTG TAT GCC TTG T | Quencher-1 | WT Probe | ||
| 38300 | Fluorophore-2 | CCT ATT CAA GCC ATA GAG TTC CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38296 | 0.40 uM |
| 38297 | 0.40 uM |
| 38298 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.