For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 95 bp
Wild Type = 98 bp
>chr2:120666704+120666801 98bp GGACTAGCCCATCAGGTTCC TGAGCCAACAAGGGTTAGGA
Sequence
Wt Sequence (deleted region in lower case)
GAGGGTGTTCGTTCATGTGTCCAGTGTCTAGGGGTAGCAGTAGGGATCTAGAAGGGACCACATTAGTAGTGTGAACTCATCTAAGCACGATGAAGTTCACTGCAGGAAAGCATATGCCTAGGTTTCCTGCTTCTCTTATTTGTCTTATGGTGATAATCTGCCCCTCGTCTGTATgtccgtcccttttgttaGTCTCTCCTGAAAGTGCCAGCAAGTAGTCTTCTATACACTGCTGTATAGGCTAGCTCGCACACACAGCCACCCTGTGTGCTCAGGGACTCCAGGTGctttgtggtaagatgagggcatgtgggcagtgtgggtcaacagtaatgctttccttttcttgtcaccaggcctctgttgggctgactccgaggatatgtgaggtatagattctctttgggtcacgtcctccccccgtgggcttcctatgtcagcttccttcagtaaagcctaacgctctggtctgtgcagggtctcttcatcagggaggatgactgtgcctctcagccttgttcccgtagcataaaagtaaggtaagagctcaagccccagaccccagatgtcccatttccatccccagctcctttcacgtcagggtcagcagaggggtggagaaaatccgcagaggacacatcatgcagtataggaaatgggacacatactaagcctttgggttgccccggactagcccatcaggttcctcctgtgcctctgttcccctcacttcctgttgtCTCACTCTTGCTTTTGGGATTCCCCTCCTAACCCTTGTTGGCTCATTCTGGAGATTTCAGACCGACTTTCCAGACTAGTGCTAGGTACAAGGTTTTGTTTTGTTTTGTTTTGTCAGACAGCATCATGCTATGTAACCTAGGCTGGCCTCAGACCCTTTATCCTGCTGTTTTACCCTCCCAAGTGTTGTAGTTATAAGCATGATCCTCTATGGCCTAGCAAAACAAAGTTTTACCAAGCTGCATTGAGAAAAATATTGATATATGATTACTAGGTTTT
453 bp deletion beginning at Chromosome 2 positive strand position 120,666,304 bp and ending after 120,666,756 bp (GRCm38/mm10). In addition there is a 17 bp deletion (GTCCGTCCCTTTTGTTA) 96 bp before the 453 bp deletion
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38198 | TAG GCT AGC TCG CAC ACA CA | Mutant Forward | A | |||
| 38199 | TGA GCC AAC AAG GGT TAG GA | Common | A | |||
| 38200 | GGA CTA GCC CAT CAG GTT CC | Wild type Forward | A | |||
| 38201 | Fluorophore-1 | CCC TGT GTG CTC AGG GAC | Quencher-1 | MUT Probe | ||
| 38202 | Fluorophore-2 | TGC CTC TGT TCC CCT CAC T | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38198 | 0.40 uM |
| 38199 | 0.40 uM |
| 38200 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.