For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:106799813+106799895 83bp TGACACTCAAGCTCCTGCAC TGATCACAGCACAGTTTCACC
Mut= 83 bp
Wt= 83 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence: (deleted region in lower case)
GTGGAGCGGTAAGTGAGCCTTGCTTTAACAGTGGGGCTGGATAGGGCTGGCAGAGCCTTGGTGGGTAAGCATTTGCCTCATAAGCTTGATAACCTGAATTCCATTCCAAGAACCCACAGAGAAGGAGAGAAAGAACTCCCCAAAGTTGTCCTCTGACCTCCACACTTGGGTTGTGACACTCAAGCTCCTGCACAAGTATGCCTCTCCCCCCCAAAGTgtgcaaacagggggaaatggtgaaactgtgctgtgatcacctgcctgccctgctgtgagagccccccttgtctcttcttctccaagggactcatggcaggtggtggttggcttgctcatgtcattatcatgttggctcaggacagacagggtcttaacttagcctttatgtttgtctttttaaacaggtgaaactgagcagtattctaaagattctcatggagaagaagctggggaggacctagaacgtaccgaggaggcgaagtggagaaacgcttcttttatgaggtagtgtgcagtgcctgtgaatttcatcagacaagttatgcttcccactctgtgagattaagtccagcatactctaatgtccctccaaaagctgatgtgaacattttatgcctttctGAGCTCTTGACTTTCCTTTCCTATCTCTGCTTTCACAACTTTTTTCTTTTTCTTTTTTTTTTTTTTCTTTTTTTGGTTTTTCGAGACAGGGTTTCTCTGTATAGCCCTGGCTATCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGAGTAAAGGCGTGCGCCACCACGCCCGGCTCACAACTTTTTTCATTCTAGACTTTTGTTGAGATGGTTC
This is a 404 bp deletion beginning at Chromosome 11 positive strand position 106,799,857 bp and ending after 106,800,260 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 38172 | TGA CAC TCA AGC TCC TGC AC | Common | A | |||
| 38173 | TGA TCA CAG CAC AGT TTC ACC | Wild type Reverse | A | |||
| 38174 | GTT GTG AAA GCA GAG ATA GGA AAG | Mutant Reverse | A | |||
| 38175 | Fluorophore-1 | TGC AAA CAG GGG GAA ATG | Quencher-1 | WT Probe | ||
| 38176 | Fluorophore-2 | CCC CAA AGT GAG CTC TTG AC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38172 | 0.40 uM |
| 38173 | 0.40 uM |
| 38174 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.