For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 79 bp
Wild Type = 98 bp
>chr2:77288452-77288549 98bp TCCATTATCCAGCAAGGTTTG CAGTCATAGGCACCGCAGA
Sequence
Wt Sequence:
gcagtcctccctggcctgagcggaggtgagagagcaccGTTGACTGgtctcaccttcctcctgcttttgtccagatcctgtggtccactcatgtgacttttaggctttcaacgacacgggttctccattatccagcaaggtttgatatgttgacACCTCGTAGATAAATGCTGGGGATGTCCCCAAGCTCTGACCTGTGGTGTCTGCGGTGCCTATGACTGATTGTATTTCTTCCTGCATGCTCATCCATCCTGGTGTTTGTAAGTAGCAAAACAATGAGCCTGATTTGTTCTCCTTTGTAGAGCCAGGCCGAGGCCCACTACAAAGGAAGTAAACATGCCAAGAAGGTCAAAGCTCTAGAGGCAACGAAAAATAAACCCAAAATGGTTCCTTCCAAGGACAGCGCAAAGGCTAATCCCAGCTGCTCCATCAGGCCAGGCACAGGCGACAGCTCTGACAAATCAGGTCAATGGCACTTTTTGTTCTTTGGCATTGTTGTGTCCCTCCTCCCCACCCCACCCCCACCCCTGCTTCCCTCCTCCTTGGATGTTGCATGTTACTCTCCATGAGTTATTTTTGTAATATGATATGTTTCCCTCACaggaagcaatatgtgttagcagagaatgtaaacatttgatatgttgccattccatgttgtacaatatatatttata
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35366 | Fluorophore-1 | TAT GTT GAC AGG AAG CAA TAT GTG T | Quencher-1 | MUT Probe | ||
| 38135 | TCC ATT ATC CAG CAA GGT TTG | Common | A | |||
| 38136 | CAG TCA TAG GCA CCG CAG A | Wild type Reverse | A | |||
| 38137 | CAA CAT GGA ATG GCA ACA TAT C | Mutant Reverse | A | |||
| 38138 | Fluorophore-2 | TGT TGA CAC CTC GTA GAT AAA TGC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 38135 | 0.40 uM |
| 38136 | 0.40 uM |
| 38137 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.