For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 80 bp
Wild Type = 110 bp
>chr17:25268957-25269066 110bp GATAAGGAGTGGCCTGTGGT TTTGTAGCCAGCAACCTTCA
Sequence
Wt Sequence (deleted region in lower case)
TCTCAGGGCTTTGTAGCTGTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATCCCTGGAAAGAAGGGGGTAAGGGTGACTGCTGGCTTTGCACCTACTAACTTAACAGATCTGAAGGAGCAGAACTACTAGAAGGGACCTAAGTTTGCATATTTGTGACCACAGCTAGCCTGCCAGGTCACAGCTCTCCCCTGGATAAGGAGTGGCCTGTGGTGGTAAGGAGGCTTGgaccttggcaaatcactggatcagtgaacagcccggggtcaggggtaaagagcaggtgaaggttgctggctacaaagcagtaagccccaatggtgaggtgcccatggagaacccaggccgtgtttctttacactcatgggcctgagtgcagccggttgtctgcccttgtccagcacatgtaagagggatggtctcctataacttcaggcattcaccaaacccagacctctaggtcagcttagtgtctgagcaaaaacatagtttgggttcatctatacaaggctcagttgcagagtatgcagtaatggtggtgtagggcagttagagaagaagcccaaaggacccaggtttcaggaaacttctcctgggcttaccttggcaagtgagccactggtctaaccttggttccctccccacagactccatgggaaggaggcttgttcaagctacggatgcttttcaaagatgactatccgtcctcaccaccaaaatgtaagttgtgcaaagagcctgcagtccacttcccagcactaccaccaccctttgggagccatgtctgtgagtgcttggcctagtaggcaggtgccagtgctgggatagtcggtcctggtgagttgtcttggatgacaagtcccagggtagatgcgcatgtaattagtgtggtctctaatcccagcctattaggatgtaccacacatggcagagggagagttgtgtcaggctgaagcttctgggtgcttttgtgcccacaggagaactcgagtctgtaagttcccatagattacgtgagtggttagcatatatcagctgagttccattcagagcactaaaggagagaggagactcttactcatccccatctgctgtgttctgtgggatgctcatggccttcagaccatggggtcagaagagaaggctggactgatctctgttcagctcagcagaacttgcttgGGGGTACAGTGCCCACCACCACCATTCTGCCCAGGATAAGTAAGGCCAGGTCTGAGCTGGTTTATAAATAGATGTTACCTGATGCAGAGTTCCCCAGGAGTACTAAAACATAGTTTATTGGGAACCACTAGATGGAGTCTTGCCTGTTCTGTTTGGGATTTCCTTGTCTGCCTGAGTTCTTTTGTTAGTTTTTTCTTTTAAGGGGTATGTAGCTAGGATTGAGGTAGACAGAGTTGTTGGTCTCTTTCCTTTCGTGTGGTGCTGGA
954 bp deletion beginning at Chromosome 17 negative strand position 25,269,032 bp and ending after 25,268,079 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37953 | GAT AAG GAG TGG CCT GTG GT | Common | A | |||
| 37954 | GCC TTA CTT ATC CTG GGC AGA | Mutant Reverse | A | |||
| 37955 | TTT GTA GCC AGC AAC CTT CA | Wild type Reverse | A | |||
| 37956 | Fluorophore-1 | CAG TGC CCA CCA CCA CC | Quencher-1 | MUT Probe | ||
| 37957 | Fluorophore-2 | TGA ACA GCC CGG GGT C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37953 | 0.40 uM |
| 37954 | 0.40 uM |
| 37955 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.