For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:55251612-55251694 83bp TCTGGCACTGAATGGAAGAC TGAAAATGACCACTGCTGGA
Mut= 80 bp
Wt= 83 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence: (deleted region in lower case)
TGTTTAGCAAATTGTATCTTATATCTTGGGTATCCTAGGTTTGGGGCTAATATCCACTTATCAGTGAGTAGTTACTCTGGTTCTAAATGTTCTCGGTAATCTGATTTCAGCACTCAGTTCTTCTGTCATTCAGCAGGGGAAGGCTGGCGTGCGTATCCTTTGAACAGCAGGCTCAAGGAAACAGAGGTGACACAGAATGTGTCAAAAAGTCTCCTGTCCCATACTAAATCAATGACTACCACTCTTAATAACGTGCACACTGGATAAAGACTAGAAATGAGTTACACAAAGGAGATGATAAATAAAGGAGCGAACACTTAAGTCGTTCACCTGCcctctactgtgcttttatgacttacttctgcttttatgtgtttttctgcttcagcggaaagagacatcagtgtctactgtggagtgcaggccattacgatgaagattaatttttgcacggtccttttctcgggatattcagaaacagatctggcactgaatggaagacatggggattcccactgcaggggcttcatcaataacaacacctttccagcagtggtcattttcatcattaatctcagcaccttggagggctgtggaaacaatttagtggtaagatttctatgaaatcctgtgctatacctgaggtcataaataaacaagctccagtttcacgaaataatcaggagctcaatctatcttcaggaaaaaaaattccaataaagccaaacaaatcattttcctttgcttgtttaaaggttgaactcccaaatatacaattctgtcttctgataatggttctgttgataggagcTGGGCTGGAGAGATGCATGTGCTCCGctatggtcctCTAAGCAGCGTTCTGTTAGATTGACATTGATGGGCATCTCTAACAACGAGCCATATTCTTCATGCTTCTATGGGTACCTCAGATCATAAGAATGTTTTTGTTCCTTTGCTGTGATCTAGATCTTATGACCTCATTCAGTAAGAAAGATTGAAGATAAAATGGGAAACCTGAACTCGTTTTTCATGTTTACCCTTGACTGGTAGCCATCAATATTCTGTAAAAGAAAGCTGTATCTTGTGGGAAGTTCTTCATAGTGTAGGACTGCCCATTACATTTAAAAAATGCTTATTCTATCCAGTTTTATCCATAGTATTCTGGAAGTGCCCCTTTCCAGTTATTTT
This is a 477 bp deletion beginning at Chromosome 16 negative strand position 55,251,842 bp and ending after 55,251,366 bp (GRCm38/mm10). In addition there is a 10 bp deletion (CTATGGTCCT) 26 bp after the large deletion that will not alter the results of the exon deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37931 | TCT GGC ACT GAA TGG AAG AC | Wild type Forward | A | |||
| 37932 | TGA AAA TGA CCA CTG CTG GA | Wild type Reverse | A | |||
| 37933 | GGA GAT GAT AAA TAA AGG AGC GAA C | Mutant Forward | A | |||
| 37934 | GAT GCC CAT CAA TGT CAA TCT | Mutant Reverse | A | |||
| 37935 | Fluorophore-1 | TCC CAC TGC AGG GGC | Quencher-1 | WT Probe | ||
| 37936 | Fluorophore-2 | TGG GCT GGA GAG ATG CA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37931 | 0.40 uM |
| 37932 | 0.40 uM |
| 37933 | 0.40 uM |
| 37934 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.