For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 136 bp
Wild Type = 139 bp
>chr1:86024644+86024782 139bp AACAATGTCTCTGGTTTGGTG GTGAATGGCTAACCAATGTGT
Sequence
Sequence (deletion in lower case, insertion in carrots)
GTAGAAAGCAAAACCTTCCAGCACCACATCTTTAAACCTTTAAAACGATAGGGTATTGAAGAGGCAAAGGAGGGACTGTCCATGGCCTACTGAATTTGTTAACTTTCTCATCACCGTGACCCAGTTATCTGAGAAATTACTGAAACGATGACTTATTCACGTTGGCTCACGGTTTTAAGAGTATCCACGTATCACGGCAAGGTGTAGCTCACAGTGAATCTGCTAGGAAGTGGAGAGAGGGATTATGTGAAGGGCCCAAGGCAAGATATAACCTGCAAAGATGTCCCACTGATGCCCTACAacacctgctagaatccgcctcttagcctttaccaactcccaataacatgacttctagaactgtcctagagactgtgtcccactcccaagaaccaggtgcagtcctcatctctctccttctctgtccagcagtgcctctgacctatgtggccccacgctcctgctcctgtgcagcctgcccgggcagctccgcttgctggcatcgtctggggctttgccatagccgaatctttgatgtcctcctacctcgggactggtcatccatgccagggagaggagtcccaaaccttctcaccttctacaggttccgcatgaacgggagggctaaaaagccttgggtgtagagttcccagggccaggctcggtcctcagatctggttggcaactgtgtgtaacttcctccaaacatcataggcttttcaaaagcaaagccgttccttctaaataacaatgtctctggtttggtgggccagctctttgtctgttcctttttctatgaaaccgtcttctctgctgacagcaccctcccaccCAGCCCATTGTAAACTCCAGAGCTGTGTGATTACACATTGGTTAGCCATTCACTTTTTTTTTTTTGACCCATACCATACACAGGGAGtgtctattta^GGTTTTTT^TTAAACGGCATGTTAATTATCCCTGGAACTCAATGATAAACCTGATCGCGTAACTCATAGGTCCCTTCTGCCAATAATAGCAAAATCTGTCCCACACAGAACATGCCATGCTTTTACCAGGAGTCCTCACAGGGGCCATGTTTTCTAGACCAGTCTATTAG
531 bp deletion beginning at Chromosome 1 positive strand position 86024199 bp and ending after 86024729 bp (GRCm38/mm10). In addition there is an indel (8bp insertion GGTTTTTT and a 10 bp deletion TGTCTATTTA) 85 bp after the 531 bp deletion
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37769 | TCT GCT AGG AAG TGG AGA GAG G | Mutant Forward | A | |||
| 37771 | GTG AAT GGC TAA CCA ATG TGT | Common | A | |||
| 37772 | AAC AAT GTC TCT GGT TTG GTG | Wild type Forward | A | |||
| 37773 | Fluorophore-1 | AAA GAT GTC CCA CTG ATG CC | Quencher-1 | MUT Probe | ||
| 37774 | Fluorophore-2 | CTG CTG ACA GCA CCC TCC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37769 | 0.40 uM |
| 37771 | 0.40 uM |
| 37772 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.