For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 150 bp
Wild Type = 158 bp
>chr13:64799187-64799344 158bp GCAAAACTATTTGAAAGAAGACAGC TGTCTGCATTTGTGTTTCCTG
Sequence
Sequence (deleted region in lowercase, indels in parentheses)
GACAAAATTGGTGCATACGTGCTATGGGATGCCACAGTACCAGGAGACTAAGTTTCCGTGAAACTGTTCACCTCGGGACTGTGTCCAGGTTCCTAAATCTGTCAAGCAAGTCATTACTGGAGTGGATGTAGCAAATAGTAGATAATTGAGAAAGCAAAACAAAATTGCTATATCTATGTTAAACATTAGCAAAACTATTTGAAAGAAGACAGCCTTTT(ggata)TAGGCAGAGTGAACACATGCCACCATTGAtataagctatgataatacaaaaatgatcttgaagatacgttgacccttcctctttgttttttacagggatttccaggaaacacaaatgcagacagtgtggtacaatatagtctccagccttccttccacaccaggttcctgcgcttcctccccttaacctggaaccctaaaggcaggattgggatgcggatagaagtatatgggtgttcatacagtaagtgatatttattttccatgtaaaataaacatctgcatgagatgctgcaaaagccagcgtcAGTTAAAAATTACTTGCTCTAGACATTTTTAGTAATTGTATAATTAAAACCGA(gt)GTTATGAGACTTCTACTAACTCCTTATGACAATATAGGCTTTAATTATTTTTTTCATAGTTAAATTTAGAGATTGCTTAGTGAGAAAAATGTTTGATAGGAAATAAGGGTGTAATTTTGGAGCCCTAGTATCACATAAAAGGGCAGGTGTACAGTGAATGTCTACGAACCCAGTGCTGGAGACAGAGAACAGAGACAGGTAAATCT
278 bp deletion beginning at Chromosome 13 negative strand position 64,799,280 bp and ending after 64,799,003 bp (GRCm38/mm10). There are 2 additional small deletions, a 5 bp (GGATA) deletion 29 bp before the exon deletion and a 2 bp deletion (GT) 53 bp after he 278 bp deletion
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37711 | GCA AAA CTA TTT GAA AGA AGA CAG C | Common | A | |||
| 37712 | TGT CAT AAG GAG TTA GTA GAA GTC TCA | Mutant Reverse | A | |||
| 37713 | TGT CTG CAT TTG TGT TTC CTG | Wild type Reverse | A | |||
| 37714 | Fluorophore-1 | TGC CAC CAT TGA AGT TAA AAA TTA C | Quencher-1 | MUT Probe | ||
| 37715 | Fluorophore-2 | TGA TCT TGA AGA TAC GTT GAC CC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37711 | 0.40 uM |
| 37712 | 0.40 uM |
| 37713 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.