For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 105 bp
Wild Type = 105 bp
>chr10:94294873-94294977 105bp TTGCAACTGCTAGGCTCAG TGGCTCATGAAGCAAATTCA
Sequence
Sequence (deleted region in lower case)
AACAGGGTGACTCACTTCAAATGACGGCCGACAATGAATGATATACAATTAAGCGTGTGGGCCCCAGGGGCAGACTGCATGGACAGAGTCCTGGCTTTGTGATTTTGGGCAATTGAATCTTCTTGTGCCTCAGATTCTTCATTTGCAAACCAGGAACCCTAATGCTGCCTATCCTTGGAGACTAGGATGGGAAAGGAAGCCTGCTACATATGACTCAGCAGCAGAATTGTCACCCTGATGgtcatgggagtctgcttgcttggactaaacctttttatttctctccttattccaggactgcttgtgcccctcccccacacagcccagtggccaggattcctgcctaactatatcccaagaattgagcctaggactctctttggtctgctctggctcataaaagccaagacgaggtgaggcactcctttctgtttctgcttctccgttcactcaccaattcacaaatgattttctgcatgtgtgtttgtgtaatagagaactgtccctttaaatgtgtgtgtcacagatcttgtctcctgctgggattgcagtggcctgaaggcagggaacaaatactgccacaaaaggccttaggctttgtagtacacatggtctcagttgcaactgctaggctcagctgacaaagcatgaggtagccttagacaagatgagagatttcgtttacaaagagcaggcCACTGGCTGAATTTGCTTCATGAGCCATAGTTTCCTAACTTCCAAGCTAAAGCATATTTTAAAAAATTGTTTTTCATCTCTCATTCCCTGTCCGGCTTTTTAGAAATGATTGGGATTATGCTGTGTCTGTTTGCTTATTTTTAAAGCATAAGCAGGAGGCTTTTTGTGGATCTGTATTCGACTTTACTATATTGGCTATGCACGTTCCTCTAGCCTTTCTCCTGTGTTTGTG
456 bp deletion beginning at Chromosome 10 negative strand position 94,295,355 bp and ending after 94,294,900 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37704 | TGC TGC CTA TCC TTG GAG AC | Mutant Forward | A | |||
| 37705 | TGG CTC ATG AAG CAA ATT CA | Common | A | |||
| 37706 | TTG CAA CTG CTA GGC TCA G | Wild type Forward | A | |||
| 37707 | Fluorophore-1 | TGG GAA AGG AAG CCT GC | Quencher-1 | MUT Probe | ||
| 37708 | Fluorophore-2 | AAG CAT GAG GTA GCC TTA GAC AA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37704 | 0.40 uM |
| 37705 | 0.40 uM |
| 37706 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.