For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 99 bp
Wild Type = 140 bp
>chr3:146896888+146897027 140bp TAAGCCCGTGTCATTTCCA CTTTGTCCACTAAGACAATCCATTC
Sequence
Sequence (deleted region in lower case)
TGTTGGGGAAGCCCTGAGGGTGAATGTACCTGTGTAGAGTTATATCAGCTGTCTCTGTGTTTTTACTGTACTAAAGTCACTCTCTAAACCctctgCAAGTGCTGTGTTTTGGGAAATTGCGCAGGACTATGACTAAGGCTTTTTGGTGCAACCTAATTCAGTTCCCAGCTTCTGTGGAGAGCAATTTGGTAAAAGTGCCGTCACTGGTAATGAGCTTATGCTATAAGGAGTGGggccagtctgcacctggaacactgtgggtatacgcatgtgcatttccattgtgaatgtctttaaggtgttctggctcaggtttgatgtaatcgtctcttttcagttcgtttagtaatagatgagatgggatttatgaaaactcctgatgaagatgagacaagcaatcttatctggtgtgatgctgctgttcagcaggagaagattacagacctgcagaactaccaggtggggactgacagtcagcatcggggagaaagtcacaccacttccaccacttccgtcatggttttatttagcttcttaatctgtccacatattagctttcagttctgagttccctgggccgcctgtctcgttgctcgctggctgtgctgactctttgcattaagcccgtgtcatttccaaactcaacctttagcttttttctttaaagatggatcaacagggaaaaattctaagttgatgctttgagttatgtacaccttaagatgagtgacagGGAATGGATTGTCTTAGTGGACAAAGACCTTATAGCTTCAGCTCCATTAGTCTGACTTTTACATCTATAGTGCAGTACAAATGTGTTTAGAAGAAATGGAAAGCAAATTGAAAAACCTACAAGGGATCCAAAGCAATCGATGTTTGCTACTTACCCTCCCTCCCTTCTTCCCCTTCCTCTCTCCTCCTCCCTCCCTCCCTCTCTCCTTCCCTCCTTTCCTCCCTCCCTTCCTCCCTCCTTCTCTCCTTCCTTCCCTCCCCTTTCCTTCCTCTCCCCTCCTTCCC
500 bp deletion beginning at Chromosome 3 positive strand position 146,896,502 bp and ending after 146,897,001 bp (GRCm38/mm10). In addition there is a 5 bp deletion (CTCTG) 138 bp before the 500 bp deletion
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37693 | GTT CCC AGC TTC TGT GGA GA | Mutant Forward | A | |||
| 37694 | CTT TGT CCA CTA AGA CAA TCC ATT C | Common | A | |||
| 37695 | TAA GCC CGT GTC ATT TCC A | Wild type Forward | A | |||
| 37696 | Fluorophore-1 | AGT GCC GTC ACT GGT AAT GA | Quencher-1 | MUT Probe | ||
| 37697 | Fluorophore-2 | TGG ATC AAC AGG GAA AAA TTC T | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37693 | 0.40 uM |
| 37694 | 0.40 uM |
| 37695 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.