For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 110 bp
Wild Type = 137 bp
>chr1:172491303+172491439 137bp CCACCAGGAAGTCTCACCTC GCCACTCGCTTTTCCAAGT
Sequence
Sequence (deletion in lower case):
AGAACCGATTAATTGATGGCCCACTGCAGTATCGTTCTCCTTGGTACTTGAGAAGTACAGCCCTGGGTAATACAGTTAAAGCCAGAGACCCTGACATGAGGAAGGCCCACCAGGAAGTCTCACCTCCCTTTCTGACCTCCCTGgaccctcccgcacatacagtttctcagcagaaggaatcagggtgggtaggcttgcctgccatgcctcgtgaaacagggctgacttggaaaagcgagtggcctctggaacaggatgggcttttatcacacatcccaattcgggtccttaaggtcctgtagcaacttggcccatgactacaaagggcagaaccaggaagaggtgtagaaaggccctgagggttctgggaattccggaatgggctgaggacacctttctgccttggtacttctcccaggaccccctgtcattgtggtgccccccagcaacagtacagtcaactcctctcaggatgtttccttggcctgccgggctgaggcataccctgctaacctcacctacagctggttccaggatggtgtcaatgtcttccatatcaggtagggcaacctatctcttgggtagtggaggcaggggattgatgtgtagtctctgggagagctccttgtctaaggactaggttcctcctcacacataccatattgcagccgcttacagtctcgagtgcgcatcctggtagacgggagcctgtggctacaagccactcagcctgatgacgccggccactatacctgtgttcccagcaatggctttctgcatccaccgtcagcttctgcctatctcactgtgctctgtaagtccccatgctccttccacagcctgctcctccgcactgagacagactgatgaccttgtcctccaacttgtctctgcattcctccagacccagcccaggtgacagtcatgcctcccgagacacccctgcccactggcatgcgtggggtgatccggtgtccggttcgtgctaatcccccactactgtttgtcacctggaccaaagacggacaggccttgcagctggacaaggtacaggcttgtgacaggggatgaaggtcttggctaggtgttgtttttgtcagagggccagctgcagctcagcgggaggctgagtttaattcagcgctgtggttgggaaacatgtttcttaccagatgccagtgttaggcagtgactgtggaggtgagaagaagtatccatttccccagaagaagtatccatccttggagtgttgccttgaggcagagctgccacagagactctgctgtcaggccagggaaggaacaagGCTTTTGTTTTTAGGTCCGGTTGGGGATAGACCAGTAACAGATCCTGGGCCTTTGGTGAGGTGGTAGGTCTTGAAGAGTGAGCTGTCATTCCATGCAGAAATCCCTTTGCAGAGGCCGTATAGTGTGCTGACAAAGTGATGAATCGGGCAGTGAGGGGGAGCC
1163 bp deletion beginning at Chromosome 1 positive strand position 172,491,340 bp and ending after 172,492,502 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37683 | CCA CCA GGA AGT CTC ACC TC | Common | A | |||
| 37684 | CAA GAC CTA CCA CCT CAC CA | Mutant Reverse | A | |||
| 37685 | GCC ACT CGC TTT TCC AAG T | Wild type Reverse | A | |||
| 37686 | Fluorophore-1 | ACC AGT AAC AGA TCC TGG GC | Quencher-1 | MUT Probe | ||
| 37687 | Fluorophore-2 | CTC CCG CAC ATA CAG TTT CTC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37683 | 0.40 uM |
| 37684 | 0.40 uM |
| 37685 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.