For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:57647918+57648007 90bp TTGATGGAGAAGTCCTGCTG TTCCCGAAGCACTTTGGACT
Mutant= 95 bp
Wild Type = 90 bp
Sequence
Wt Sequence: GACAGATTTGATGGAGAAGTCCTGCTGGAAAAGATGTGGACcaaaaggtgtcatctgttgtcttctctccttcccacagtccaaagtgcttcgggaaaaatggctgctgcagggtgtaccagcgggaacagcggaggaggaggaagccaggcgcaggcagtctgaagaagatgaattcaaagtcaagcagcttgaagataacattcagaggtaggtagttcccagcctgcagtaaccactgctctcctgaaggggacgctttcgccgtgctgcgacttttccctggggctgtagattgctgtcctaaatagatactggtgtcggctaacttttCAGTGTGAGTTGCTGTTATTCCTCAGCGAATAGTACAGAGATGGTTTCCCCCACCAATGAGGTCTTTATTATAAGCAGTCTGCCCTCCCCCAAATGCTCTCCTGTAAGT
Deleted Sequence: caaaaggtgtcatctgttgtcttctctccttcccacagtccaaagtgcttcgggaaaaatggctgctgcagggtgtaccagcgggaacagcggaggaggaggaagccaggcgcaggcagtctgaagaagatgaattcaaagtcaagcagcttgaagataacattcagaggtaggtagttcccagcctgcagtaaccactgctctcctgaaggggacgctttcgccgtgctgcgacttttccctggggctgtagattgctgtcctaaatagatactggtgtcggctaactttt
292 bp deletion beginning at Chromosome 4 negative strand position 57,648,243 bp and ending after 57,647,952 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37627 | TTG ATG GAG AAG TCC TGC TG | Common | A | |||
| 37628 | TTC CCG AAG CAC TTT GGA CT | Wild type Reverse | A | |||
| 37629 | CTC ATT GGT GGG GGA AAC | Mutant Reverse | A | |||
| 37630 | Fluorophore-1 | AGT GTG AGT TGC TGT TAT TCC TCA G | Quencher-1 | MUT Probe | ||
| 37631 | Fluorophore-2 | AGG TGT CAT CTG TTG TCT TCT CTC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37627 | 0.40 uM |
| 37628 | 0.40 uM |
| 37629 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.