For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 107 bp
Wild Type = 141 bp
>chr4:152280454+152280594 141bp TCGACAGCTAGGACCTTTTTG TGACCTTCTCCGGTCCTTAG
Sequence
Wt Sequence (deleted region in lower case):
ATTCTACACCCTCACACTGGCCACCTGCTTCTCTGTCACCTCCATCTCCTACCACCGCATGTGGATGGTCCGATGGCCAGTCAACTACCGGTGAGCGCAGGACAGCCTGGTGTTCTGAGGGAGGGGCTGTGcttgaggcaaaggcatgcctggtgtacctgtatgagggctccagaatgggtgatggggttgagggctggcatagtctggggctactggggggggggtgtgcgtgttgaggtagttatggcagaatgttagtgtagcttggtacacaagtgcctcgtgagagggacagggacacgaatagcttttgagtgaggtacaaggctctgccatgatggctgggtggaggctacagtgtcagtggggagggatggtctgggccctctgtggtcccatagaggcctgtgagtaacaccaggattctctattctgccctgctccctgccaggctgagcaacgccaagaagcaggcggtgcacacagttatgggcatctggatggtgtccttcatcctgtcggcccttcctgccgttggctggcacgacacgagcgagcgtttctacacccacggctgccgcttcatcgtggccgagattggcctgggcttcggcgtctgcttcttgctgctggtgggaggcagcgtggccatgggcatggtctgcacagccattgccctcttccagacactggccacgcaggtggggcaccgggctgaccgccgcaccttcaccgtgcccaccatcgtggtggaagacgcacagggcaagcgtcgctcctccattgatggctcagagcctgccagaacttcgctacagatcacgggccttgtggccaccattgtggtcatctatgactgcctcatgggtttccctgtgctggtgggtgaggtttgatgggtagggaacctctcagggatgtggcttctaggacagcctggggactgatggctgaaatgataaacctgacttttgagctgtcagttagcactcccattttatggatttggcagacagggttcagagaggttcaaagtcagggtagaagggtgagatgaacctcgacagctaggacctttttgtcacactgtaggcggtctttcccaggatgcagtaggtagatagggaacactgagttggcatagggcaggcccctaaCTTTCTGTGATATTGCGCTTTACCCTAAGGACCGGAGAAGGTCAAATTAAAGACTCACTGGAAGAAGGCCTTGCTAGCCACAG
1029 bp deletion beginning at Chromosome 4 positive strand position 152,279,522 bp and ending after 152,280,550 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37233 | TCC GAT GGC CAG TCA ACT AC | Mutant Forward | A | |||
| 37234 | TGA CCT TCT CCG GTC CTT AG | Common | A | |||
| 37235 | TCG ACA GCT AGG ACC TTT TTG | Wild type Forward | A | |||
| 37236 | Fluorophore-1 | CGC AGG ACA GCC TGG T | Quencher-1 | MUT Probe | ||
| 37237 | Fluorophore-2 | TTG GCA TAG GGC AGG C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37233 | 0.40 uM |
| 37234 | 0.40 uM |
| 37235 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.