For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 150 bp
Wild Type = 151 bp
>chr7:3424603+3424753 151bp GCTGCACAGGTCTTTCTGACT AAGCCGAGATTCTGCTGTTC
Sequence
Wt Sequence (deleted region is in lower case)
CTTGCATTTGGGGCTCAGCTTTTTCTCATTCCCGATCTAGTTGACACTGAGCCTACTACTTCCTTTGAAAGTCTAGGCCCTGCCCCCTGCCCCTTAGGACCCGCTGCACAGGTCTTTCTGACTCCTTGAGGCTCGCCTGAGCTCCAGCGGATCCCATCATCATGatgtggtctaacttcttcatgcaagaggaagaccgacgccggacagctgtgggccggcgtcgtgcccaagaacagcagaatctcggcttgactccggagcgagagggcaagatcaagctggggttgctggtggcaatcgtgggtgctacgctggctgtgctggctgtgggcaccgagttctgggtggaactcaatacatacaagaccaatggcagcgccgtctgtgaggccgcccatttggggctgtggaaggtgtgcatcaagcgactgtggcaggcggatgtgcccgcgggcagggagacctgtggcccAGCTGAGCTGCCAGGAGGTGAGAGGCTGTGTTCTGAGCCCAGATCTGTGTCCCACAGTCAGGGAGAAAGAAACTTTTGTCTGGGGGAAACTTTTGTCTTGTTCTTATCCCCCAAGAATGTTTGTGCCCAAATCAACCTGTGCTCACAGAAACTGGAGAGAAAGGGGGCGGGGAGAGTGAGAG
This mutation is a 311 bp internal deletion beginning at Chromosome 7 negative strand position 3,424,975 bp and ending after 3,424,665 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37166 | GCT GCA CAG GTC TTT CTG ACT | Common | A | |||
| 37167 | AAG CCG AGA TTC TGC TGT TC | Wild type Reverse | A | |||
| 37168 | TTC CCC CAG ACA AAA GTT TC | Mutant Reverse | A | |||
| 37169 | Fluorophore-1 | TGG TCT AAC TTC TTC ATG CAA GAG | Quencher-1 | WT Probe | ||
| 37170 | Fluorophore-2 | ATG AGC TGA GCT GCC AGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37166 | 0.40 uM |
| 37167 | 0.40 uM |
| 37168 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.