For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 117 bp
Wild Type = 137 bp
>chr11:100713810+100713946 137bp GGAAGATAAGACAGCGACTTGA GCATCCGAGAGTGCAACTG
Sequence
Wt Sequence (deleted region lower case): GATGGAGCTGTAACCCCGCACATTCAGGTGATCCAGTTCCTTCATAGCCTCCTTCCTGCCCTCTGATGTGAGAGAAGGGCCCAGGGAGAAGCAGAAGCCGGTTCTGGACAAAAGCTGCAGCGCTTGCAAGGAAGATAAGACAGCGACTTGAGTGTTTTTGCCCTTCTGGATGGGAAGAGTGGgcgggcccttcctcttcgcacccgccccggatggggggttggggagccctcgcgccctcaggcagcagttgcactctcggatgcagcgggtaggaagcagtttctccaccgggcagcgcgaacccggggaaaaccgggtagcttcccgatgtcccagcgtggcccttgctgaacggaatcaagtggccactctaccagtgaggctgctcagggatgaggtgcagggcaatggctgtgagcaaccaagtttccaaataaaggtggatgcccaaggtttcgctccggaggacttggtgGTGCGGATAGACGGCCAGAATCTGACGGTGACCGGCCAGCGGCAACACGAGTCGAATGACCCGAGCAGGGGCCGCTACCGCATGGAGCAGAGTGTTCACCGACAAATGCAGCTCCCGCCGACCTTAGATCCTGCAGCCATGACCTGCAGCCTGACCCCCTCTGGCCATCTGTGGCTCAGGGGACAAAACAAGTGCCTACC
296 bp deletion beginning at Chromosome 11 positive strand position 100,713,863 bp and ending after 100,714,158 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37116 | GGA AGA TAA GAC AGC GAC TTG A | Common | A | |||
| 37117 | TCG GGT CAT TCG ACT CGT | Mutant Reverse | A | |||
| 37118 | GCA TCC GAG AGT GCA ACT G | Wild type Reverse | A | |||
| 37119 | Fluorophore-1 | TCT GAC GGT GAC CGG C | Quencher-1 | MUT Probe | ||
| 37120 | Fluorophore-2 | CCC TTC CTC TTC GCA CC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37116 | 0.40 uM |
| 37117 | 0.40 uM |
| 37118 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.