For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:61002528-61002658 131bp CAGACATGGGGGTGCTTAG GCACTAGCGTTCTCACTACGG
Mutant= 131 bp
Wild Type = 145 bp
Sequence
Wt Sequence: CTATAAAATTTTCTTATGGACAGAAAAAAATGTGAAGTGTCATTGAAAGCATTAGAATGGATTCTCAGTTCCAGATCTTTCACTTTATTTCACTTCCTGTAAtgacttacaacagtccagacatgggggtgcttagcagtgctgtggttctgattcatactcctcagaaggcaggtgtaactgagtctgttatctctttactgtttaaaggacggaccctgcaggtaccgtagtgagaacgctagtgctaatatcacagattatgtgaacctcccaccgaatgagctttacctatgggttgctgtagcatctattgggcctgtctctgctgccattgatgcttctcatgactctttcaggttctacaatggaggtaagcatatttccttctagatgtgaaaaaaatgaagaattgtgacatcccaatgccatgccatgctatgttcttatctataagattttatgtgagtttgagtttctcgattgccttccctgtgcaatcatactgagtcctatctttaaCTGATATGACCCTCTCATGAAAGTAAGTATATCATATGTTATAAAATTTATGTTTAGTTTATTTTTAAACTATCCC
Deleted Sequence:
tgacttacaacagtccagacatgggggtgcttagcagtgctgtggttctgattcatactcctcagaaggcaggtgtaactgagtctgttatctctttactgtttaaaggacggaccctgcaggtaccgtagtgagaacgctagtgctaatatcacagattatgtgaacctcccaccgaatgagctttacctatgggttgctgtagcatctattgggcctgtctctgctgccattgatgcttctcatgactctttcaggttctacaatggaggtaagcatatttccttctagatgtgaaaaaaatgaagaattgtgacatcccaatgccatgccatgctatgttcttatctataagattttatgtgagtttgagtttctcgattgccttccctgtgcaatcatactgagtcctatctttaa
420 bp deletion beginning at Chromosome 13 negative strand position 61,002,673 bp and ending after 61,002,254 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37053 | GGA TTC TCA GTT CCA GAT CTT TCA | Mutant Forward | A | |||
| 37054 | AAA ATC TAA AGC ATC CAC CAA A | Mutant Reverse | A | |||
| 37055 | CAG ACA TGG GGG TGC TTA G | Wild type Forward | A | |||
| 37056 | GCA CTA GCG TTC TCA CTA CGG | Wild type Reverse | A | |||
| 37057 | Fluorophore-1 | TCC TGT AAC TGA TAT GAC CCT CTC AT | Quencher-1 | MUT Probe | ||
| 37061 | Fluorophore-2 | CTG TGG TTC TGA TTC ATA CTC CTC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37053 | 0.40 uM |
| 37054 | 0.40 uM |
| 37055 | 0.40 uM |
| 37056 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.