For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:43943235+43943339 105bp AAACCAAAAGCACCATCAGC GCCAATCGGAATGTACAACTG
Mutant= 91 bp
Wild Type = 105 bp
Sequence
Wt Sequence: GGCAAGGGGAAGCAGGAAGGTTAATTCCAGGACAGTCAGAGCTCTATGAAATGCTGTCTCCAAAAACCAAAAGCACCATCAGCCTTGGCCCTggcagcagccgtcacagctctgaccactctccccacttacacctgaaggtaatcccagttgtacattccgattggctcagcgtgccaaggctgatggtgtctgaggcactcaggcctggagaagggcagctctagctgaggtgcagcgtagctgtgccactgaacagaacaataccagtgagaccacagcaggagcttgtctcatcagtgtttgagttagaatgtcatcttttcccctaggtcactatcctgtcccctttgtgggaaaggccacctgtggagagcagtggttgtacactcagccattccccagaaagaaccaccaagggtaattgtcagggtcctctcccagatgtctctgggagcacacctggcacggagcagtgcaaggctgtagcagctgagacctctgagcagcctggtagctgtgaacgacctgggaccacaaggcaggaggcagaagctgcttgtgtgaggcatttccaccgtagccatgtgtaccagcaacagctgattgagaagcaaaagaagaaacttgagcagcagcagaaaaccattcagaagctaaaggaaaaccagcgcttggccgaggcccggtgggcagctaagcgagccccggcagtcacagaaggacagaactgccttcagtcagaccccagaggagcaagggacccgcagggcacctgccagaggcttctgaagtatgtcagcagggtcacagcactcggaatgtgtttgcagggttttcctctaagctcagtagctttgcttggcttcctgtatgctcacaaagccaggaacctcatgtatgctgactgtcccatgccaggtgtacagagataagcaaatggccgcctagacggataccattttacagtgagccctgggtggttgtgagacaaacactggaattatgtaggaaaagagaaaaatacgtgttctaagcttttgggtttctgatggtttaatgctgagaaacgagGGCAGACAGCATGGTCCCCAGGAGCAGCCCCAGGGCTGGCTCATTGACTCACTTGAATTTTCAGTTGTTCACAGTAAAAC
Deleted Region: ggcagcagccgtcacagctctgaccactctccccacttacacctgaaggtaatcccagttgtacattccgattggctcagcgtgccaaggctgatggtgtctgaggcactcaggcctggagaagggcagctctagctgaggtgcagcgtagctgtgccactgaacagaacaataccagtgagaccacagcaggagcttgtctcatcagtgtttgagttagaatgtcatcttttcccctaggtcactatcctgtcccctttgtgggaaaggccacctgtggagagcagtggttgtacactcagccattccccagaaagaaccaccaagggtaattgtcagggtcctctcccagatgtctctgggagcacacctggcacggagcagtgcaaggctgtagcagctgagacctctgagcagcctggtagctgtgaacgacctgggaccacaaggcaggaggcagaagctgcttgtgtgaggcatttccaccgtagccatgtgtaccagcaacagctgattgagaagcaaaagaagaaacttgagcagcagcagaaaaccattcagaagctaaaggaaaaccagcgcttggccgaggcccggtgggcagctaagcgagccccggcagtcacagaaggacagaactgccttcagtcagaccccagaggagcaagggacccgcagggcacctgccagaggcttctgaagtatgtcagcagggtcacagcactcggaatgtgtttgcagggttttcctctaagctcagtagctttgcttggcttcctgtatgctcacaaagccaggaacctcatgtatgctgactgtcccatgccaggtgtacagagataagcaaatggccgcctagacggataccattttacagtgagccctgggtggttgtgagacaaacactggaattatgtaggaaaagagaaaaatacgtgttctaagcttttgggtttctgatggtttaatgctgagaaacgag
982 bp deletion beginning at Chromosome 16 positive strand position 43,943,264 bp and ending after 43,944,245 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37043 | AAA CCA AAA GCA CCA TCA GC | Common | A | |||
| 37044 | GCC AAT CGG AAT GTA CAA CTG | Wild type Reverse | A | |||
| 37045 | GAA AAT TCA AGT GAG TCA ATG AGC | Mutant Reverse | A | |||
| 37049 | Fluorophore-1 | AGA CAG CAT GGT CCC CAG | Quencher-1 | MUT Probe | ||
| 37050 | Fluorophore-2 | AGC TCT GAC CAC TCT CCC C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37043 | 0.40 uM |
| 37044 | 0.40 uM |
| 37045 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.