For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:5457322-5457479 158bp GGAGCCTGAGAGGCAACC GCACCAGCTCCTCCTTACC
Mutant= 136 bp
Wild Type = 158 bp
Sequence
Wt Sequence: GGAGCCTGAGAGGCAACCGGCCCGAGGAGGGGCTCCAGAGCCTCGGCCGTGGGCGGGCGATGCTGCAGCTGCCTGATCAACTATGGAggCCGAAGCAGGCGGCCTGGAGGAGCTGACGGACGAGGAGATGGCGGCGCTGGGTAAGGAGGAGCTGGTGC
Mutant Sequence: GGAGCCTGAGAGGCAACCGGCCCGAGGAGGGGCTCCAGAGCCTCGGCCGTGGGCGGGCGATGCTGCAGCTGCCTGATCAACTATGGAggTCGTAGCTTCGGCTGAGCACCAGGGCGCTGGAATGGACTGGAAAAGC
680 bp deletion beginning at Chromosome 19 negative strand position 5,457,391 bp, GCCGAAGCAGGCGGCCTGGA, and ending after GCTGTGGACCTCCAGACCTG at 5,456,712 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 35171 | GGA GCC TGA GAG GCA ACC | Common | A | |||
| 35172 | GCA CCA GCT CCT CCT TAC C | Wild type Reverse | A | |||
| 35173 | GCT TTT CCA GTC CAT TCC AG | Mutant Reverse | A | |||
| 35174 | Fluorophore-1 | TAG CTT CGG CTG AGC ACC | Quencher-1 | MUT Probe | ||
| 35175 | Fluorophore-2 | ACG AGG AGA TGG CGG C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 35171 | 0.40 uM |
| 35172 | 0.40 uM |
| 35173 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.