For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
Wt Sequence (deleted region is in lower case and insertion is indicated with ^^)
ATCATATATTTTATGTGTGTGTGTGCATACATGTATACCGCAGAATATATTTGGAGGTCAGAGGGATAAACACTTTAAAAATTTTAAAGTATTTTCAACAACATGGGAGTTAGTTTTCTCCTTTAATCATGCAGAGTCCAGGAACCAAACTCAGGCCACTAGACTTCAATAGCAAGTGCATTTATCTGTAGAGCCACCCTAATTTTGGAGGATTATTTTATTTTGGATAATCTAGAAAATAGTTTCTATATTAGAGCATTTTTTATTCTTATTTCATTAGCATATCCCATTGTGCTCA^ATTGTAAAAGGGTCAGTTGAAGTTATTA^tcaataggccttcttattaattcctatttataatttattaattcctatttataacttcaactgacccttttacaatttttttttgaaaaatatttaatatcctttaatcttttttttaatcttcaggtcagcccaagccagaggtgacttggtataagaatggtcaagccatagacttgggaggcactgtttccagttatgagttctttgagaaccagtatattcatttgttgcatctctcgtggtaagtggcttggcctctgtgaactactcactaaaattctgtcttccatggtgtgctcatgtttgcctcagaagtcctggactttgatgttactgtcaggcaacagcctaaccagccagtactgactaaagtgttccctctgtatgaatggattacctgaatatttaatgaaccgtgaggctgaaaatatttttaagaattgtattgggattagggatggttatcttcactccctagacagtatagcacACTAGTAATTTACCTATAATTTATTTCATATTAACATGGGGGTGATTTGTACAAACAGTATATCATATTATATAGGAAAGAGACTTAAGTATCCTCAGGGCTGATTATCTGGGAACTGAGATCTCCATAGGACAATGAAGAGTGATCATATTCATTAAGCTAAGTAACTATTTGGCCTTCTCTAGTTTACCATTGATAGACTTAAACTTTATCTAGAATTCTAGGGTT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34075 | CAT TAG CAT ATC CCA TTG TGC | Common | A | |||
| 34076 | TTG GGC TGA CCT GAA GAT T | Wild type Reverse | A | |||
| 34077 | Fluorophore-1 | CAT CAA TAG GCC TTC TTA TTA ATT CC | Quencher-1 | WT Probe | ||
| 34078 | Fluorophore-2 | TTT CAT ATT AAC ATG GGG GTG A | Quencher-2 | MUT Probe | ||
| 34079 | GAT AAT CAG CCC TGA GGA TAC TT | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 34075 | 0.40 uM |
| 34076 | 0.40 uM |
| 34079 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.