For in-depth product & services help, ask our
Technical Information Scientists
Notes
This mutation is a 555 bp deletion beginning at Chromosome 10 positive strand position 28,263,339 bp, TTTTCTATGGCCCTGCCCCA, and ending after TGTTTCCCAACTCCTTCTTG at 28,263,893 bp (GRCm38/mm10).
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 124 bp
Wild Type = 150 bp
Sequence
Wt genomic sequence with the deletion in uper case
ctgaatccgactcctgcttgtctaccatctgaccctaagttagcagttatgtcccatatttctatattgtaaatcagggttaatatcaagttgtagagatgaataaactgtttttgtctagtttatgaaatgttagtaagaaatggatctacgtgatgtcttgactgatatTTTTCTATGGCCCTGCCCCAGAAGACATTTTAAAATTTAATGTTTTCATAGAGTAATATCCTATAATACTCTATGAAATTTTATAGTTGTAATATTTTACAGTTGTTTGATACCCCTGGCTTATCAATGTTCTTAGCTCTGTTATTTGTAATGTCATTTCAGGTTCCTATATGGTTGTGGACTCCTCAAATCATGATCCTGGAGAAAAAGCCAGACTTCAGCTGCCTACCATGAAGGAGAATGACACCCACTGCATTGATTTCAGTTACCTGTTATATAGCCAGAAGGGGTTGAACCCTGGCACTTTGAATATCCTAGTTAGGGTGAATAAAGGACCTCTTGCTAATCCAATTTGGAATGTAACTGGATTCACTGGTCGTGATTGGCTTCGGGCTGAACTAGCTGTGAGCACCTTTTGGCCCAATGAATACCAGGTAATCCCCTGAGATTTTTCTGGTTTGTGCTGTCTTGTATTGGGTATCTTTGTATATATAGATATAAATACTGGTCCTGCAGGAGTAGGATCCCTCCTTCTTGTTTCCCAACTCCTTCTTGaggaggagtttgagtgccttgacacagaaccttctaactatagaaaatatttccatgcatagaaaacagtagtttggcccacaatttgttgt
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 32631 | GAA ATG GAT CTA CGT GAT GTC TTG | Common | A | |||
| 32632 | Fluorophore-1 | CCT GCC CCA GAA GAC ATT T | Quencher-1 | WT Probe | ||
| 32633 | Fluorophore-2 | AGG AGT TTG AGT GCC TTG ACA | Quencher-2 | MUT Probe | ||
| 32634 | CAG GGG TAT CAA ACA ACT GTA AAA T | Wild type Reverse | A | |||
| 32635 | ACA ACA AAT TGT GGG CCA AAC | Mutant Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 32631 | 0.40 uM |
| 32634 | 0.40 uM |
| 32635 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.