For in-depth product & services help, ask our
Technical Information Scientists
>chr15:99703306+99703571 266bp CTGGGGGTGAAGGAAAGAAG TGATCAGGTTGGGATAGGAA
Mutant = ~350 bp
Heterozygote = ~350 bp and 266 bp
Wild type = 266 bp
The reverse primer (primer 57530) anneals over the nucleotide sequence containing mouse genomic variation rs212395954.
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
57529 | CTG GGG GTG AAG GAA AGA AG | Forward | A | |||
57530 | TGA TCA GGT TGG GAT AGG AA | Reverse | A |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTPS-kapa | 0.26 mM |
57529 | 0.50 uM |
57530 | 0.50 uM |
Glycerol | 6.50 % |
Dye | 1.00 X |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 94.0 | -- | |
2 | 94.0 | -- | |
3 | 65.0 | -- | -0.5 C per cycle decrease |
4 | 68.0 | -- | |
5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
6 | 94.0 | -- | |
7 | 60.0 | -- | |
8 | 72.0 | -- | |
9 | -- | repeat steps 6-8 for 28 cycles | |
10 | 72.0 | -- | |
11 | 10.0 | -- | hold |