Stock No: 034711
Protocol 37042: Probe Assay - APP-SAA KI Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  83 bp

Wild Type = 88 bp

chr16:84963001-84963088 88bp GCTTCAGATCCCTGCAGACT TGGAACAATGAGCAACAGGT

Sequence

Wt Sequence: cacctgctgtgggcaggaacggagtgacctgtttccagaacaatggcggggacctctatttggtttttaccaaatgcttacctgttaaagggcttcagATCCCTGCAGACTTCTAcctcatgatgcaccagagaaattgACTTCAGAACCCGGGAAGCCACCTGTtgctcattgttccagagacgaggacgctcagtcctagggacccaccaactcacgcttcgctgagctatggcggagggtcccctgaaactttgctacat

 

Mutant Sequence: tcgaaacccttttggtcatgaccattctcggtccacgatagttttatttgaagaattggtcttaaataagcatgtggggagtacttggttgtagggatgctctctcgcagtgcttggttaGATCATAAGAAGTTCCTATACTTACTAGAGAATAGGAACTTCGGAATAGGAACTTCGGCGCGCCACTAGTttaagttctcatctacaaatggataatttcagtccattccaacccctcctccttcctactgcttccccacctcccagtatttctttggcttacaagggaaagttagcagagaccctttaaggtgagtgaagcccagcggtgactttgccgcctcagcttctcagtcagaaatcttgggcaaggcagatagca...       ...tatttggtttttaccaaatgcttacctgttaaagggcttcagatccctgcagacttctacctcatgatgcacACGCGCCGAAGTTCCTATACTATTTGAAGAATAGGAACTTCACTAGTcagagaaattgacttcagaacccgggaagccacctgttgctcattgttccagagacgaggacgctcagtcctagggacccaccaactcacgcttcgctgagctatgg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
14256 AAC TTC GGA ATA GGA ACT TCG Mutant Forward A
50360 GCT TCA GAT CCC TGC AGA CT Wild type Forward A
50361 TGG AAC AAT GAG CAA CAG GT Wild type Reverse A
50362 GGA GGG GTT GGA ATG GAC Mutant Reverse A
50363 Fluorophore-1 CGC GCC ACT AGT TTA AGT TCT CAT C Quencher-1 MUT Probe
50364 Fluorophore-2 CCT CAT GAT GCA CCA GAG AAA TTG Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
14256 0.40 uM
50360 0.40 uM
50361 0.40 uM
50362 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.