Protocol 37361: Probe Assay - Lipm<em1(IMPC)J> Alternate 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr19:34109607+34109725 119bp AACGGAAGATGGGTACATCC TCTGGGCTGCAAGAAGACT

 

Mut = 147 bp

Wt = 119 bp

Fam = Mut

Hex = Wt

Sequence

Wt Sequence (deletions in lower case):

TCACCAATACTGCAAAATATAAAAACTAATCACACTTAAATCCAAGGAGAATTAGCTGGTTTGACCTAAGTAGCGTCAGTTAGGGAGAGACCAGGACCTTCTTGCAATGCCAAAGAAGCTACTCCTACCCTtgagttgttgggattgtggccatgtagacctgaagtctaaataaatattgaggcttttgtttgtttttccttagagcgaaatcatcaaacacaagggttatcccagtgaggagtatgaagttgcaacggaagatgggtacatcctttctgtgaacagaatccctcggggacagacacggttaaagaaggaaggtatggtttactcagtgtcactccaacatgacagtcttcttgcagcccagactttcttgatatttggaattaagttttggttcttaggacagactaagatcctttggttaggGGGAATGATAGAGTCAGTCCCCGAGTAATCCCTATCTACATTGCCAGAGTATATTTCATCCATACTCATAGTAAGCAACTATCTCAGAGGTATGTTTCAAAAATACCTTTGATCTGCTGAAGGATCACAGGGGAAGGACATA

This mutation is a 304 bp deletion beginning at Chromosome 19 position 34,109,483 bp and ending after 34,109,786 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49675 AAT CCA AGG AGA ATT AGC TGG TTT G Mutant Forward A
51155 AAC GGA AGA TGG GTA CAT CC Wild type Forward A
51156 TCT GGG CTG CAA GAA GAC T Wild type Reverse A
51157 Fluorophore-1 ATC CCT CGG GGA CAG ACA C Quencher-1 WT Probe
51270 GGA TGA AAT ATA CTC TGG CAA TG Mutant Reverse A
51271 Fluorophore-2 CCT TCT TGC AAT GCC AAA GAA G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
49675 0.40 uM
51155 0.40 uM
51156 0.40 uM
51270 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.