Protocol 34348: Probe Assay - Avpr1a<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr10:122448339+122448466 128bp CGCTGCATGACTTTAAATTGG CAGGGGTGGAGCTGAGAAT

Mut= 129 bp

Wt= 128 bp

Fam=Mut

Hex=Wt

 

Sequence

Wt Sequence (deletion in lower case):

 GGGCCTGGGGGCTTGGAAGGGTGGACCCCAAATCCAGGCGCACTGAGTTCGCAGCAGCAGCAGACGCGGATCTCTACGTACGCTTTTACTACACCTGTTGACGCGCTGCATGACTTTAAATTGGCTTATAAAGGAGGCTGGAGAAAttccgaggagcccagagaagtttggggcagatccggaaagcgcccggctctgcagaggaatctaggattctcagctccacccctgcagcaccaaagagaaaaggacaaatcaccaacgacttggaggggttgggtgtaggggacagtctccagccactaagatgagaaggagcgcatcctgaggcagcctaagactgctttgggagcagggagagtccgctcccttgcctcggacaagccggagcagggacacgcaagaacatcccatccaaaaccactctgagcgcgcgtgggattgcgcagcgaagagagcgaggtaaggaaggacggtgcgcagaacttaggacgcgggtcttcgggtcctccgtggagaagaggaagcagcccacgaggaacagggttccccggctctgtgccgacagcatgagtttcccgcgaggctcccacgatctgcccgcgggcaactccagcccgtggtggcctctgaccaccgagggcgccaacagcagccgggaagcagctgggctcggggaaggcggcagcccgccgggggacgtacgcaacgaggagctggcgaagctggaggttaccgtgctggcggtgattttcgtggtggccgtgctgggtaatagcagtgtgctgctggcgctgcatcgcacgccacgcaagacatcccgcatgcatctcttcatccgacacctcagcctggcagacctggcggtcgccttcttccaagtgttaccacagctgtgctgggacatcacctaccgcttccgcgggccggactggctgtgccgggtggtgaagcacttgcaggtgtttgccatgttcgcatcttcctacatgctggtggtgatgacggctgaccgctacatcgccgtgtgccacccgctcaagaccctgcagcagcccgcgcgccgctcgcgcctcatgatcgccgcctcttgggggctgagtttcgttctgagcataccacagtactttatcttctctgtgatcgaatttgaggtgaacaatggcaccaaagcccaagattgctgggctaccttcatcccgccctggggtacccgtgcctacgtgacctggatgaccagcggggtcttcgtggtacccgtgatcatcttgggtacctgctatggcttcatctgttaccacatctggcgcaatgtccgagggaagacagcatcgcgacagagcaaaggcggcaagggctctggggaagccgcgggtcccttccacaaggggcttctggtcacgccttgtgtcagcagcgtgaagagcatttcccgtgccaagatccgcacagtgaagatgacctttgtgattgtaagcgcctacatcctctgctggacacctttcttcatcgtccagatgtggtcagtctgggataccaatttcgtttggaccggtatgtactgagactactatggaagaggtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgcctgtgtgtttgtggtgtgtgttggggggggagtgtttgtggtgtgtgtgtgtatgtatgttatttttcatacaacctattcaaTAGTTAAGCTTCTATGTAAGAAGTCTTAAATGAACAAAATTGCAAATTCCTGGGACCTCCACCCCAGGTACACTGGAGCCCAGGATTCAGCATCTGCAGCATGTGTGACCACCCTAAGGCCACCAGCTGTGCCTAGAGTCACTAGTTACAAAACACTTGTGACATTTTGCCAAATTAC

This mutation is a 1550 bp deletion beginning at Chromosome 10 position 122448382 bp and ending after 122449931 bp (GRCm38/mm10).

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
43365 CGC TGC ATG ACT TTA AAT TGG Common A
43366 CAG GGG TGG AGC TGA GAA T Wild type Reverse A
43367 ATC CTG GGC TCC AGT GTA CC Mutant Reverse A
43368 Fluorophore-1 CGA GGA GCC CAG AGA AGT TT Quencher-1 WT Probe
43369 Fluorophore-2 CAA ATT CCT GGG ACC TCC A Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
43365 0.40 uM
43366 0.40 uM
43367 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.