For in-depth product & services help, ask our
Technical Information Scientists
Mutant = G/G
Heterozygote = A/G
Wild type = A/A
>chr11:70822500-70822604 105bp CCCCTCCAGTCAGTGAGTATCT TAGCTCTGGCTGGCTGACTG
The Rev primer (primer 54332) anneals over the nucleotide sequence containing mouse genomic variation rs225759573 and the WT and Mut probes (primer 54333 and 54334) anneal over the nucleotide sequence containing mouse genomic variation rs259100961.
GAACTTGTACTCTGAGGGCCCCTCCAGTCAGTGAGTATCTGGATTTGCAAGACAGGCAAGAGGACA(a/g)GTCCTGGTCTCTTGCCCTAACACACAGGCAATCAGCCAGTCAGCCAGCCAGAGCTATATTTAGATTTCTGTCAT
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
54331 | CCC CTC CAG TCA GTG AGT ATC T | Forward | A | |||
54332 | TAG CTC TGG CTG GCT GAC TG | Reverse | A | |||
54334 | Fluorophore-1 | CAA GAG GAC AGG TCC TGG TCT | Quencher-1 | MUT Probe | ||
54624 | Fluorophore-2 | AAG AGG ACA AGT CCT GGT CT | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
54331 | 0.40 uM |
54332 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |