Protocol 21155: Probe Assay - Trp53<tm1Brn> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  145 bp

Wild Type = 63 bp

Sequence

Wt Sequence:tccatggattgctgtattggaatcaaacagaaatctatgtcattcacagcagtaacctcctgggaatacttcaagagacggagaaagggcgactgactgtgccctccgtcctttttcgcaatcctttattCTGTTCGAAtcataatttgt

tttcctgagacagggtttctctgtgtagtcctggctgtcctgggactcccctctgtagaccaggctggcctccaactgtctctgcctcctatgtgctgggatcaaaggtgcctgccaccaccgcctggcttcttagagttgg

 

Mutant Sequence:GAGACGGAGAAAGGGCGACTGACTGTGCCCTCCGTCCTTTTTCGCAATCCTTTATTCTGTTCGAtaagcttgatatcgaattcataacttcgtataatgtatgctatacgaagttatctgcagcccg

ggggatctgatatcaTCGAATCATAATTTGTTTTCCTGAGACAGGGTTTCTCTGTGTAGTCCTGGCTGTCCTGGGACTCCCCTCTGTAGACCAG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
31852 CGT CCT TTT TCG CAA TCC T Forward A
31853 GAA ACC CTG TCT CAG GAA AAC Reverse A
31854 Fluorophore-1 CAA TCC TTT ATT CTG TTC GAA TCA T Quencher-1 WT Probe
31855 Fluorophore-2 TGC TAT ACG AAG TTA TCT GCA GCC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
31852 0.40 uM
31853 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
026512 B6(Cg)-Tg(TPO-cre/ERT2)1139Tyj/J
032435 B6.129-Krastm4Tyj Trp53tm1Brn/J
032429 STOCK Krastm4Tyj Trp53tm1Brn Tg(Pdx1-cre/Esr1*)#Dam/J
3 strains use this protocol