For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 032127
Protocol 32483: Probe Assay - Cx3cr1<tm1Litt> Probe Alternate1
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 85 bp
Wild Type = 110 bp
>chr9:119961380-119961489 110bp CGTGATCTGGTTTCTCCTTCC CCAAATAACAGGCCTCAGCA
Sequence
Wt Sequence: tcctttaaggctcacgtgatctggtttctccttcccctccagGACCTCACCATGTCCACCTCCTTCCCTGAACTGGATCTAGAGAATTTTGAGTATGACGATTCTGCTGAGGCCTGTTATTTGGGCGACATTGTGGCCTTTGGAACCATCTTCCTGTCCGTCTTCTA
Mutant Sequence: GGACCTGCTTACTGCATGCAGCCAGTGAGAACTACAATCCTTTAAGGCTCACGTGATCTGGTTTCTCCTTCCCCTCCAGGACCTCccgcgggcccgggatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgac
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 31017 | CGT GAT CTG GTT TCT CCT TCC | Common | A | |||
| 32856 | CTC CTC GCC CTT GCT CAC | Mutant Reverse | A | EGFP | ||
| 39210 | CCA AAT AAC AGG CCT CAG CA | Wild type Reverse | A | |||
| 39211 | Fluorophore-1 | CCA GGA CCT CCC GCG GG | Quencher-1 | MUT Probe | ||
| 39212 | Fluorophore-2 | CCA GGA CCT CAC CAT GTC CAC C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 31017 | 0.40 uM |
| 32856 | 0.40 uM |
| 39210 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.