For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 030849
Protocol 32415: Standard PCR Assay - Traf6<tm2Ywc> Alternate 1
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:101696085+101696307 223bp GCCTGTTTTCTTTTTACTCACCTG CAAACCTCTACGGGTCATGC
Mutant = 130 bp
Heterozygote = 130 bp and 223 bp
Wild type = 223 bp
WT primers can create a non-specific product at ~375bp that can be ignored for scoring purposes.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39050 | CGA AGT TAT TAG GTC TGA AGA GGA | Mutant Reverse | A | |||
| 39051 | GCC TGT TTT CTT TTT ACT CAC CTG | Common | A | |||
| 39052 | CAA ACC TCT ACG GGT CAT GC | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 39050 | 0.50 uM |
| 39051 | 0.50 uM |
| 39052 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.