For in-depth product & services help, ask our
Technical Information Scientists
This assay will NOT distinguish hemizygous from homozygous transgenic animals.
Genotyping by PCR is performed to determine the absence or presence of the transgene. This strain has some variability in repeat size, therefore Southern blotting is performed to accurately determine the size, in kilobases, of the repeat within the transgene.
Transgene = 207 bp
Internal positive control = 415 bp
Tg Sequence: GGACACAATTCAACCCACAAGTGTCAGTCTCTAGCTGAGCCTTTCCCTTCCTGTTTTTCTCCTTTTTAGTTGCTATGGGTTAGGGGCCAAAT
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
21238 | CTG TCC CTG TAT GCC TCT GG | Internal Positive Control Forward | A | |||
21239 | AGA TGG AGA AAG GAC TAG GCT ACA | Internal Positive Control Reverse | A | |||
34480 | AGG CCC CAC TCT AAT CCA GT | Transgene Forward | A | C9ORF72 | ||
34481 | TGG AGA TTT GGC CCC TAA C | Transgene Reverse | A | C9ORF72 |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTP KAPA | 0.26 mM |
21238 | 0.50 uM |
21239 | 0.50 uM |
34480 | 0.50 uM |
34481 | 0.50 uM |
Glycerol | 6.50 % |
Dye | 1.00 X |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 94.0 | -- | |
2 | 94.0 | -- | |
3 | 65.0 | -- | -0.5 C per cycle decrease |
4 | 68.0 | -- | |
5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
6 | 94.0 | -- | |
7 | 60.0 | -- | |
8 | 72.0 | -- | |
9 | -- | repeat steps 6-8 for 28 cycles | |
10 | 72.0 | -- | |
11 | 10.0 | -- | hold |