For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 030222
Protocol 30377: Standard PCR Assay - Tg(C9ORF72*)1Rhbr Alternate1
Version 1.0
Notes
This assay will NOT distinguish hemizygous from homozygous transgenic animals.
Genotyping by PCR is performed to determine the absence or presence of the transgene. This strain has some variability in repeat size, therefore Southern blotting is performed to accurately determine the size, in kilobases, of the repeat within the transgene.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Transgene = 207 bp
Internal positive control = 415 bp
Sequence
Tg Sequence: GGACACAATTCAACCCACAAGTGTCAGTCTCTAGCTGAGCCTTTCCCTTCCTGTTTTTCTCCTTTTTAGTTGCTATGGGTTAGGGGCCAAAT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 21238 | CTG TCC CTG TAT GCC TCT GG | Internal Positive Control Forward | A | |||
| 21239 | AGA TGG AGA AAG GAC TAG GCT ACA | Internal Positive Control Reverse | A | |||
| 34480 | AGG CCC CAC TCT AAT CCA GT | Transgene Forward | A | C9ORF72 | ||
| 34481 | TGG AGA TTT GGC CCC TAA C | Transgene Reverse | A | C9ORF72 |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 21238 | 0.50 uM |
| 21239 | 0.50 uM |
| 34480 | 0.50 uM |
| 34481 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.