Stock No: 028900
Protocol 18492: End Point Analysis Assay - Card14<em#(delE138)Lutzy>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ---/---
Heterozygote = GAG/---
Wild type = GAG/GAG

Sequence

TGGAGACATCCAAGCTGACCGAGTGTCTGGCTGGGGCCATCAGCAGCCTGCAGGAG[gag]CTG
GCCCAGGAGAAGGCACAGAAGGAGGTTCTGCTCCGGAGATGCCAGCAGCTGAA
 
Mutation is a GAG deletion.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
27140 ATC CAA GCT GAC CGA GTG TC Forward A
27141 CAT CTC CGG AGC AGA ACC TC Reverse A
27142 Fluorophore-1 CAG GAG GAG CTG GCC C Quencher-1 WT Probe A
27143 Fluorophore-2 TGC AGG AGC TGG CCC Quencher-2 MUT Probe A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
27140 0.40 uM
27141 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
028882 C57BL/6J-Card14em5Lutzy/J
028900 C57BL/6J-Card14em9Lutzy/J
2 strains use this protocol