For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 028900
Protocol 18492: End Point Analysis Assay - Card14<em#(delE138)Lutzy>
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = ---/---
Heterozygote = GAG/---
Wild type = GAG/GAG
Sequence
TGGAGACATCCAAGCTGACCGAGTGTCTGGCTGGGGCCATCAGCAGCCTGCAGGAG[gag]CTG
GCCCAGGAGAAGGCACAGAAGGAGGTTCTGCTCCGGAGATGCCAGCAGCTGAA
Mutation is a GAG deletion.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 27140 | ATC CAA GCT GAC CGA GTG TC | Forward | A | |||
| 27141 | CAT CTC CGG AGC AGA ACC TC | Reverse | A | |||
| 27142 | Fluorophore-1 | CAG GAG GAG CTG GCC C | Quencher-1 | WT Probe | A | |
| 27143 | Fluorophore-2 | TGC AGG AGC TGG CCC | Quencher-2 | MUT Probe | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 27140 | 0.40 uM |
| 27141 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.