Stock No: 028096
Protocol 30686: Probe Assay - Gata6<tm1Hadj> Probe
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 81 bp
Heterozygote = 81 bp and 105 bp
Wild type = 105 bp

>chr18:11053602+11053706 105bp TCTCTTCACCGAGGCATCC GCTAACTCTGAGCCGGTGAC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
34487 GCT AAC TCT GAG CCG GTG AC Common A
35185 ACA AAG TGG TTG ATA TCT CTA TAG TCG Mutant Forward A
35186 TCT CTT CAC CGA GGC ATC C Wild type Forward A
35187 Fluorophore-1 CAG GGT GAG ACA GCA TTA ACA CA Quencher-1 WT Probe
35188 Fluorophore-2 CAG TAG GCG GTT AAC ACA CAT TAA AT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
34487 0.40 uM
35185 0.40 uM
35186 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.