Stock No: 027197
Protocol 40477: Probe Assay - Trem2<em2(KO)Msasn> Probe Alt 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:48348428+48348522 95bp TTCCAAGCAAGTGGCTGTCT ATGACACCCTCAAGGACTGG

Mutant=  104 bp

Wild Type = 95 bp

Sequence

Wt Sequence: ttccaagcaagtggctgtctcctctgcagCCCTGTCccaagccctcaacaccacggtgctgcagggcatggccggccagtccttgagggtgtcatgtacttatgacgccttgaagcactg

 

Mutant Sequence: ttccaagcaagtggctgtctcctctgcagCCCTGTCCTGAAGAAGCGGAATGGGAGCACAGTCATCGCAGATGACACCCTTGCTGGAACCGTCACCATCACTCT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
21122 ATG ACA CCC TCA AGG ACT GG Wild type Reverse A
24643 TTC CAA GCA AGT GGC TGT CT Common A
55471 AGA GTG ATG GTG ACG GTT CC Mutant Reverse A
55473 Fluorophore-1 TGC AGC CCT GTC CTG AA Quencher-1 MUT Probe
56122 Fluorophore-2 CTC AAC ACC ACG GTG CTG Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
21122 0.40 uM
24643 0.40 uM
55471 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.