Stock No: 016894
Protocol 21975: End Point Analysis Assay - Kif1a<lgdg>L181F-EP
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = T/T
Heterozygote = C/T
Wild type = C/C

Sequence

ctgatggtacatctcagcctcactttgggggtcctgatggtacagcccagcctcacttggg
gttctgatgatgttgctctgcagGTCAGCTACATGGAGATTTACTGTGAGCGAGTCCGTGA
CCTCCTGAACCCCAAGAACAAAGGCAACCTGCGTGTGAGGGAGCACCCTCTGCTGGGGCCT
TATGTGGAGGAC(c/t)TCTCCAAGCTGGCTGTAACCTCCTACAATGACATCCAGGACCTCA
TGGACTCAGGGAACAAGGCCAGgtatgtggggtgacttgttctccttagccacactctccc
ctcttgccctgtccttatagcactactagcctcacctcatgataagtcagtgtggtggctc
ccaagaggataaaggacctcatgtggcaggccactgaggacacatatcagcttg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
19090 ATG GAG ATT TAC TGT GAG CGA G Forward A
19091 GGT CCT GGA TGT CAT TGT AGG Reverse A
19092 Fluorophore-1 TGT GGA GGA CCT CTC CAA GCT Quencher-1 WT Probe
19093 Fluorophore-2 TGT GGA GGA CTT CTC CAA GCT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
19090 0.40 uM
19091 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.