For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 014141
Protocol 29000: Standard PCR Assay - Prkaa1<tm1.1Sjm>
Version 2.2
Notes
An additional primer was provided by the Donating Investigator for this strain.
cccacataggaaagcgtgtt: deleted allele is around 500bp
Please note, this primer is to be used in conjuction with the two primers listed below in order to detect the null allele. This third primer has NOT been validated by the Transgenic Genotyping Service at The Jackson Laboratory.
Sequence information provided by the Donating Investigator:
The loxPs are inserted as below;
ctcccggcttgtggagctctgcatctttggtctccaacgactagcttcatgtcctgttttctctcctggcttgt<5’loxP>tttgctcttaccttaccataagtgtgccaagcaggctcccaactgg
gcaaaacaaacttttatttatttttttggagacagggtcacactatgccactgtgactgc<3’loxP>catgtagatcaggctggcctccagtgcatagccatgcccctgtctctgtctcccaagtgc
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 450 bp
Heterozygote = 334 bp and 450 bp
Wild type = 334 bp
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 11528 | CCC ACC ATC ACT CCA TCT CT | Forward | A | |||
| 11529 | AGC CTG CTT GGC ACA CTT AT | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 11528 | 0.50 uM |
| 11529 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.