For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 83 bp
Wild Type = 95 bp
Wt Sequence: TGTGACCACGACTGCCTCTGGGAAGCGCATCCGGAAGAATCACGCCTGCGAGATGTGCGGCAAGGCCTTCCGCGACGTCTACCACCTGAACCGAC
Mutant Sequence: tagagCTTGGGCTGCAGGTCGAGGGACCTAataacttcgtatagcatacattatacgaagttatATTAAGGGTTCCGGATCAA
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
21822 | GTC GGT TCA GGT GGT AGA CG | Wild type Reverse | A | |||
33242 | AGA GCT TGG GCT GCA GGT | Mutant Forward | A | |||
33243 | TTG ATC CGG AAC CCT TAA TAT AAC | Mutant Reverse | A | |||
33244 | Fluorophore-1 | AGG GAC CTA ATA ACT TCG TAT AGC ATA C | Quencher-1 | MUT Probe | ||
33245 | Fluorophore-2 | AGC GCA TCC GGA AGA AT | Quencher-2 | WT Probe | ||
33246 | TGT GAC CAC GAC TGC CTC T | Wild type Forward | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
21822 | 0.40 uM |
33242 | 0.40 uM |
33243 | 0.40 uM |
33246 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |