Protocol 21786: Probe Assay - Del(7Slx1b-Sept1)1Aam Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  83 bp

Wild Type = 95 bp

Sequence

Wt Sequence: TGTGACCACGACTGCCTCTGGGAAGCGCATCCGGAAGAATCACGCCTGCGAGATGTGCGGCAAGGCCTTCCGCGACGTCTACCACCTGAACCGAC

 

Mutant Sequence: tagagCTTGGGCTGCAGGTCGAGGGACCTAataacttcgtatagcatacattatacgaagttatATTAAGGGTTCCGGATCAA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
21822 GTC GGT TCA GGT GGT AGA CG Wild type Reverse A
33242 AGA GCT TGG GCT GCA GGT Mutant Forward A
33243 TTG ATC CGG AAC CCT TAA TAT AAC Mutant Reverse A
33244 Fluorophore-1 AGG GAC CTA ATA ACT TCG TAT AGC ATA C Quencher-1 MUT Probe
33245 Fluorophore-2 AGC GCA TCC GGA AGA AT Quencher-2 WT Probe
33246 TGT GAC CAC GAC TGC CTC T Wild type Forward A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
21822 0.40 uM
33242 0.40 uM
33243 0.40 uM
33246 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.