Stock No: 009248
Protocol 32875: Probe Assay - Tia1<tm1Andp> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  109 bp

Wild Type = 117 bp

>chr6:86367604+86367720 117bp AGGCCAGCCAACACTACAGA ACAGCACCATGGGGAAAAG

Sequence

Wt Sequence: atggccaggtgaggtatggggcctagccttttaatcaaaacagtcaggaagcagaagaaggcagatttctatgagttcaaggccagccaacactacagagtctagAATGaatgagagaaggaaagaaagaaacaaattaggctaaagcctctagaaactggagacctatgttacctccttttccccatggtgctgtgcacatgctaactaccagatagttatggaactactcaaatttgaatgaaacataacagtaatatggaaaactaatggagaggaacccaggggaaatgagtggataactttaaattgtggctcggagtggtggtgcatgcctttaatccagcactagggaagcagaggcaggtggatc

 

Mutant Sequence:CAGGGCCAGCTCTTCAGCTTGGCCTGGATGAGGGGCAAGGCCAAATCTCCTGCTTATAGCCAAAAGTCAGGACTGACTCACATGTTCAGGACTGGCTCTCAGGGCCAGCTTGCCCTTCATGGCCAGGTGAGGTATGGGGCCTAGCCTTTTAATCAAAACAGTCAGGAAGCAGAAGAAGGCAGATTTCTATGAGTTCAAGGCCAGCCAACACTACAGAGTCTAGAActagtggatcccccgggctgcaggaattctaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgcta

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
40145 CTA AAG CGC ATG CTC CAG A Mutant Reverse A
40147 Fluorophore-1 ACC GGG TAG GGG AGG CGC Quencher-1 MUT Probe
40181 AGG CCA GCC AAC ACT ACA GA Common A
40182 ACA GCA CCA TGG GGA AAA G Wild type Reverse A
40183 Fluorophore-2 AGG CTA AAG CCT CTA GAA ACT GGA GAC Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
40145 0.40 uM
40181 0.40 uM
40182 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
009248 B6.129S2(C)-Tia1tm1Andp/J
033506 B6.Cg-Tia1tm1Andp Smn1tm5(Smn1/SMN2)Mrph/RnsMmjax
2 strains use this protocol