Stock No: 008608
Protocol 30815: Probe Assay - Dmc1<tm1Jcs> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  110 bp

Wild Type = 148 bp

>chr15:79425885-79426032 148bp TGCCCGGCCAGATTACAT CCCAAAGTGTGGAATGAAAC

Sequence

Wt Sequence:

 

Mutant Sequence:

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
35582 TGC CCG GCC AGA TTA CAT Common A
35583 CCC AAA GTG TGG AAT GAA AC Wild type Reverse A
35584 Fluorophore-1 CCC CTG CAG GTC AAT TCT ACC G Quencher-1 MUT Probe
35585 Fluorophore-2 ACT GTT TAC ATT TCC TTC CCC TCC A Quencher-2 WT Probe
oIMR6592 GAA AAG CGC CTC CCC TAC Mutant Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
35582 0.40 uM
35583 0.40 uM
oIMR6592 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.