For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 110 bp
Wild Type = 148 bp
>chr15:79425885-79426032 148bp TGCCCGGCCAGATTACAT CCCAAAGTGTGGAATGAAAC
Wt Sequence:
Mutant Sequence:
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
35582 | TGC CCG GCC AGA TTA CAT | Common | A | |||
35583 | CCC AAA GTG TGG AAT GAA AC | Wild type Reverse | A | |||
35584 | Fluorophore-1 | CCC CTG CAG GTC AAT TCT ACC G | Quencher-1 | MUT Probe | ||
35585 | Fluorophore-2 | ACT GTT TAC ATT TCC TTC CCC TCC A | Quencher-2 | WT Probe | ||
oIMR6592 | GAA AAG CGC CTC CCC TAC | Mutant Reverse | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
35582 | 0.40 uM |
35583 | 0.40 uM |
oIMR6592 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |