Protocol 34994: Probe Assay - Tg(Cspg4-cre)1Akik-Chr1-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  82 bp

Wild Type = 102 bp

This assay may be capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr 1.
This assay is designed around this insertion site, but it has not been tested on hom animals.
 
This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR.

Sequence

Wt Sequence:
gtagtccaaggatagcttatgctgcagcaatgaagggacagaaattcagcgcctatgtcagaaatacgggaatgaagctacatgtttcagttgtggAAaactgggacacccgagaaaggattgtaaaaatccctcaggaaacaagaagggccttcctccaggtccctgaccatgctgtggtaaaggaaagcactggaga
 
Mutant Sequence:
AGACCAATCCATAAACCAGGACCCTTACAGGATTATGTTAAAGCATGTATAGATGCTTCATGAACTGTAGTCCAAGGATAGCTTATGCTGCAGCAATGAAGGGACAGAAATTCAGCGCCTATGTCAGAAATACGGGAATGAAGCTACATGTTTCAGTTGTGGAAAACCACTTCCTGTGTATTCCTCTGTATTTGGGTACAGTCTCCAAGAAGCCTTCAAAACCTGCCTGGGCCAGGTTCATCCTGTTGTAGCCAACACCCATTCCTATACACTGAGAGAACACACAGACCATTTATAGATAAGCCACTTGAGCATGGGCAAGTCAGCAAGTCACAGGGGGATATCTGGGGGCAGGTTCTAGTACCAAATAAAGACAGTGTCAAC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
44985 CGG GAA TGA AGC TAC ATG TTT Common A mChr1
44986 CAG GGA CCT GGA GGA AGG Wild type Reverse A mChr1
44987 Fluorophore-1 AGT TGT GGA AAA CTG GGA CAC Quencher-1 WT Probe mChr1
44988 GGC TTC TTG GAG ACT GTA CCC Mutant Reverse A mChr9
44989 Fluorophore-2 TGG AAA ACC ACT TCC TGT GTA TTC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
44985 0.40 uM
44986 0.40 uM
44988 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.