Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 105 bp
Wild Type = 129 bp
>chr16:23157038+23157166 129bp TGTCCTGTGAAATGGATTGTG ACCCTTAGGACCAAGAAGACCT
Wt Sequence:agagtgaggaagcagagatgacggagatgatgtctttccttgtcctgtgaaatggattgtgggtagaggttccggagataatgcctcttgctggaaacagtctgggcagttctgttcccgccattcacagaattcttctcactttctagGTCTTCTTGGTCCTAAGGGTGAGACAGGAGATGTTGG
Mutant Sequence: atcgccttctatcgccttcttgacgagttcttctgaggggatcaattctctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctcgactagagcttgcggaacccttaatataacttcgtataatgtatgctatacgaagttattaggtccctcgaatcGAATTCTTCTCACTTTCTAGGTCTTCTTGGTCCTAAGGGTGAGACAGGAGATGTT
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
36281 | TGT CCT GTG AAA TGG ATT GTG | Wild type Forward | A | |||
36282 | ACC CTT AGG ACC AAG AAG ACC T | Common | A | |||
36283 | TGC GGA ACC CTT AAT ATA ACT TC | Mutant Forward | A | |||
36284 | Fluorophore-1 | AGG TCC CTC GAA TCG AAT TCT TCT C | Quencher-1 | MUT Probe | ||
36285 | Fluorophore-2 | ACA GTC TGG GCA GTT CTG TTC CC | Quencher-2 | WT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
36281 | 0.40 uM |
36282 | 0.40 uM |
36283 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |