Stock No: 008195
Protocol 31155: Probe Assay - Adipoq<tm1Chan> Probe Alternate2
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  105 bp

Wild Type = 129 bp

>chr16:23157038+23157166 129bp TGTCCTGTGAAATGGATTGTG ACCCTTAGGACCAAGAAGACCT

Sequence

Wt Sequence:agagtgaggaagcagagatgacggagatgatgtctttccttgtcctgtgaaatggattgtgggtagaggttccggagataatgcctcttgctggaaacagtctgggcagttctgttcccgccattcacagaattcttctcactttctagGTCTTCTTGGTCCTAAGGGTGAGACAGGAGATGTTGG

 

Mutant Sequence: atcgccttctatcgccttcttgacgagttcttctgaggggatcaattctctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctcgactagagcttgcggaacccttaatataacttcgtataatgtatgctatacgaagttattaggtccctcgaatcGAATTCTTCTCACTTTCTAGGTCTTCTTGGTCCTAAGGGTGAGACAGGAGATGTT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
36281 TGT CCT GTG AAA TGG ATT GTG Wild type Forward A
36282 ACC CTT AGG ACC AAG AAG ACC T Common A
36283 TGC GGA ACC CTT AAT ATA ACT TC Mutant Forward A
36284 Fluorophore-1 AGG TCC CTC GAA TCG AAT TCT TCT C Quencher-1 MUT Probe
36285 Fluorophore-2 ACA GTC TGG GCA GTT CTG TTC CC Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
36281 0.40 uM
36282 0.40 uM
36283 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.